Incidental Mutation 'R0322:Noxa1'
List |< first << previous [record 30 of 56] next >> last >|
ID25597
Institutional Source Beutler Lab
Gene Symbol Noxa1
Ensembl Gene ENSMUSG00000036805
Gene NameNADPH oxidase activator 1
Synonyms
MMRRC Submission 038532-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0322 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25085667-25095149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25092554 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 83 (F83S)
Ref Sequence ENSEMBL: ENSMUSP00000110014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044018] [ENSMUST00000114373]
Predicted Effect probably damaging
Transcript: ENSMUST00000044018
AA Change: F83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037423
Gene: ENSMUSG00000036805
AA Change: F83S

DomainStartEndE-ValueType
TPR 38 71 8.17e-1 SMART
TPR 72 105 1.47e-2 SMART
TPR 122 155 1.97e1 SMART
low complexity region 166 180 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
PB1 285 365 6.76e-9 SMART
SH3 372 427 1.81e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114373
AA Change: F83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110014
Gene: ENSMUSG00000036805
AA Change: F83S

DomainStartEndE-ValueType
TPR 38 71 8.17e-1 SMART
TPR 72 105 1.47e-2 SMART
TPR 122 155 1.97e1 SMART
low complexity region 166 180 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
PB1 277 357 6.76e-9 SMART
SH3 364 419 1.81e-14 SMART
Meta Mutation Damage Score 0.5294 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.8%
  • 20x: 84.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which activates NADPH oxidases, enzymes which catalyze a reaction generating reactive oxygen species. The encoded protein contains four N-terminal tetratricopeptide domains and a C-terminal Src homology 3 domain. Interaction between the encoded protein and proteins in the oxidase regulatory complex occur via the tetratricopeptide domains. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a targeted allele removing exons 3 through 6 exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,372 S275T possibly damaging Het
Adam34 G T 8: 43,651,921 T229N probably benign Het
Adgrb3 C A 1: 25,221,748 probably benign Het
Ankhd1 T A 18: 36,658,008 Y2478* probably null Het
Arl9 A G 5: 77,007,190 probably benign Het
Bub1b G A 2: 118,639,618 probably benign Het
Chl1 A T 6: 103,701,883 probably benign Het
Cobl T A 11: 12,267,072 E465V probably damaging Het
Cobll1 A T 2: 65,102,098 M520K possibly damaging Het
Dll3 A G 7: 28,296,368 V336A possibly damaging Het
Dnmbp T C 19: 43,854,846 H1193R probably damaging Het
Fbxo43 T C 15: 36,152,192 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gjc3 A T 5: 137,957,498 M175K possibly damaging Het
Gm9008 T C 6: 76,496,418 Y405C probably benign Het
Gpc5 T A 14: 115,399,151 N415K probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Il7r A T 15: 9,510,215 F251I probably benign Het
Insc A G 7: 114,792,265 E141G probably damaging Het
Itm2c C T 1: 85,907,030 T160M probably damaging Het
Mboat1 T C 13: 30,232,080 probably benign Het
Mdm2 G T 10: 117,702,204 H96Q possibly damaging Het
Mettl13 A G 1: 162,544,176 probably benign Het
Mfsd4b3 T C 10: 39,947,530 N245D probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Mymk A T 2: 27,067,406 L66Q probably damaging Het
Myo18a T C 11: 77,829,800 S767P probably damaging Het
Ndufa8 T C 2: 36,036,622 D134G probably benign Het
Npc1l1 T A 11: 6,229,042 I123L probably benign Het
Ogdhl A G 14: 32,337,577 T394A probably benign Het
Olfr1193 T C 2: 88,678,667 S264P probably damaging Het
Olfr290 A G 7: 84,916,313 Y178C probably damaging Het
Pcdh20 T C 14: 88,468,947 T306A probably benign Het
Pcid2 G A 8: 13,090,775 probably benign Het
Phyhip G A 14: 70,463,396 V108M possibly damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Psmb4 A G 3: 94,886,091 Y160H probably benign Het
Riox2 A T 16: 59,489,389 K369* probably null Het
Sh3tc1 G A 5: 35,706,561 P761S possibly damaging Het
Slc6a3 T A 13: 73,560,926 V323D possibly damaging Het
Smg7 A G 1: 152,849,873 probably null Het
Srrt G A 5: 137,296,608 R370C probably damaging Het
Stc1 T C 14: 69,029,409 V7A probably benign Het
Svep1 G T 4: 58,057,996 probably benign Het
Tbpl2 A G 2: 24,094,979 V51A probably benign Het
Tecr A G 8: 83,572,243 Y248H probably damaging Het
Tenm3 A G 8: 48,236,912 probably benign Het
Tia1 C T 6: 86,420,387 A114V probably damaging Het
Tmprss11f A T 5: 86,591,416 M2K probably benign Het
Tnfsf8 T C 4: 63,834,166 T221A probably damaging Het
Tubgcp5 G A 7: 55,814,978 G536S probably damaging Het
Tyr A T 7: 87,492,917 I145N probably benign Het
Ubr4 T A 4: 139,422,418 V1809E probably damaging Het
Vmn2r65 A T 7: 84,946,548 N309K probably benign Het
Other mutations in Noxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Noxa1 APN 2 25094902 missense probably benign 0.37
IGL01316:Noxa1 APN 2 25086011 missense probably benign 0.22
IGL02274:Noxa1 APN 2 25085755 missense probably benign 0.15
IGL02528:Noxa1 APN 2 25090633 unclassified probably benign
IGL02952:Noxa1 APN 2 25091761 missense probably damaging 1.00
IGL03286:Noxa1 APN 2 25085720 unclassified probably null
IGL03330:Noxa1 APN 2 25090514 missense possibly damaging 0.48
R0357:Noxa1 UTSW 2 25085850 missense probably damaging 1.00
R0636:Noxa1 UTSW 2 25086094 unclassified probably benign
R0909:Noxa1 UTSW 2 25091794 missense probably damaging 1.00
R1459:Noxa1 UTSW 2 25092546 missense probably benign 0.06
R1702:Noxa1 UTSW 2 25092584 missense probably damaging 1.00
R1958:Noxa1 UTSW 2 25090608 missense probably damaging 0.99
R4618:Noxa1 UTSW 2 25091749 missense probably damaging 1.00
R5104:Noxa1 UTSW 2 25086234 missense probably benign 0.18
R5606:Noxa1 UTSW 2 25086280 missense possibly damaging 0.67
R5619:Noxa1 UTSW 2 25085976 missense probably damaging 0.99
R5826:Noxa1 UTSW 2 25086241 missense probably damaging 0.98
R6076:Noxa1 UTSW 2 25085809 missense probably damaging 1.00
R6920:Noxa1 UTSW 2 25091832 splice site probably null
R8112:Noxa1 UTSW 2 25092541 critical splice donor site probably null
X0021:Noxa1 UTSW 2 25090214 missense possibly damaging 0.95
X0025:Noxa1 UTSW 2 25090491 critical splice donor site probably null
Z1176:Noxa1 UTSW 2 25090273 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGGATAAGCCCTGGTTTTCACATC -3'
(R):5'- CTTTAACTGGACAGTGGTCCTCAGC -3'

Sequencing Primer
(F):5'- GGTTTTCACATCTGCAAATTGGC -3'
(R):5'- CTAGGCATTTGACCAAGCAG -3'
Posted On2013-04-16