Incidental Mutation 'R2964:Nlrp4d'
ID255971
Institutional Source Beutler Lab
Gene Symbol Nlrp4d
Ensembl Gene ENSMUSG00000034122
Gene NameNLR family, pyrin domain containing 4D
SynonymsNalp4d, Nalp-beta
MMRRC Submission 040520-MU
Accession Numbers

Genbank: XM_001481310; Ensembl: ENSMUST00000184509

 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10358862-10388935 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 10378329 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 626 (S626*)
Gene Model predicted gene model for transcript(s):
Predicted Effect probably benign
Transcript: ENSMUST00000086269
AA Change: Q638K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083450
Gene: ENSMUSG00000034122
AA Change: Q638K

DomainStartEndE-ValueType
PYRIN 6 89 2.6e-31 SMART
Pfam:NACHT 150 318 2.4e-34 PFAM
low complexity region 575 586 N/A INTRINSIC
LRR 674 701 1.3e-1 SMART
Blast:LRR 703 729 8e-7 BLAST
LRR 730 756 2.1e-2 SMART
LRR 758 785 2.1e-1 SMART
LRR 786 813 1.6e-5 SMART
LRR 814 837 3.5e-1 SMART
LRR 838 865 2.7e-6 SMART
LRR 867 894 7.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182420
Predicted Effect probably null
Transcript: ENSMUST00000184509
AA Change: S626*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Nlrp4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Nlrp4d APN 7 10382094 exon noncoding transcript
IGL01076:Nlrp4d APN 7 10372083 missense unknown 0.00
IGL01656:Nlrp4d APN 7 10364147 missense noncoding transcript
IGL01889:Nlrp4d APN 7 10378334 missense unknown 0.00
IGL02110:Nlrp4d APN 7 10382564 exon noncoding transcript
IGL02271:Nlrp4d APN 7 10388698 exon noncoding transcript
IGL02637:Nlrp4d APN 7 10382555 exon noncoding transcript
snoop UTSW 7 10374891 missense probably benign 0.02
1mM(1):Nlrp4d UTSW 7 10381713 missense probably benign 0.09
F5493:Nlrp4d UTSW 7 10381084 missense possibly damaging 0.84
IGL03048:Nlrp4d UTSW 7 10358954 unclassified noncoding transcript
R0116:Nlrp4d UTSW 7 10374891 missense probably benign 0.02
R0125:Nlrp4d UTSW 7 10382389 missense probably damaging 1.00
R0390:Nlrp4d UTSW 7 10388778 missense probably benign 0.04
R0452:Nlrp4d UTSW 7 10378292 missense probably benign 0.01
R0595:Nlrp4d UTSW 7 10381045 missense probably benign 0.00
R0729:Nlrp4d UTSW 7 10377685 critical splice donor site probably benign
R0733:Nlrp4d UTSW 7 10382522 missense probably benign 0.02
R1147:Nlrp4d UTSW 7 10388717 missense probably benign 0.00
R1217:Nlrp4d UTSW 7 10364267 missense probably benign 0.36
R1378:Nlrp4d UTSW 7 10364184 missense probably benign 0.23
R1414:Nlrp4d UTSW 7 10382601 missense probably benign 0.22
R1583:Nlrp4d UTSW 7 10382237 missense probably damaging 0.99
R1585:Nlrp4d UTSW 7 10382510 missense probably benign 0.02
R1882:Nlrp4d UTSW 7 10382677 critical splice acceptor site noncoding transcript
R2422:Nlrp4d UTSW 7 10362945 missense probably benign 0.29
R2907:Nlrp4d UTSW 7 10378427 missense probably benign 0.00
R2974:Nlrp4d UTSW 7 10378440 critical splice acceptor site probably benign
R3401:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R3402:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R4240:Nlrp4d UTSW 7 10381316 missense noncoding transcript
R4682:Nlrp4d UTSW 7 10374952 missense noncoding transcript
R4766:Nlrp4d UTSW 7 10362779 critical splice donor site unknown
R4864:Nlrp4d UTSW 7 10381161 missense noncoding transcript
R4910:Nlrp4d UTSW 7 10378409 exon noncoding transcript
R5307:Nlrp4d UTSW 7 10362782 nonsense probably null
R5596:Nlrp4d UTSW 7 10382024 missense noncoding transcript
R5857:Nlrp4d UTSW 7 10382377 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACAGCGAGTTTCCACTTTAGAG -3'
(R):5'- GTGCTGTGAATTGCTTGACTTAAC -3'

Sequencing Primer
(F):5'- GAGTGTATATGCCTCAAATTACACAG -3'
(R):5'- GCTTGTACACAGTGTGCATACAG -3'
Posted On2014-12-29