Incidental Mutation 'R2964:Chsy1'
ID255973
Institutional Source Beutler Lab
Gene Symbol Chsy1
Ensembl Gene ENSMUSG00000032640
Gene Namechondroitin sulfate synthase 1
Synonyms
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location66109515-66173798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66172164 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 716 (G716R)
Ref Sequence ENSEMBL: ENSMUSP00000047487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036372]
Predicted Effect probably damaging
Transcript: ENSMUST00000036372
AA Change: G716R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047487
Gene: ENSMUSG00000032640
AA Change: G716R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Fringe 81 307 3.8e-21 PFAM
Pfam:CHGN 237 776 9.8e-197 PFAM
Pfam:Glyco_tranf_2_2 548 751 1.2e-10 PFAM
Pfam:Glyco_transf_7C 674 747 2.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181911
Meta Mutation Damage Score 0.7900 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. These enzymes possess dual glucuronyltransferase and galactosaminyltransferase activity and play critical roles in the biosynthesis of chondroitin sulfate, a glycosaminoglycan involved in many biological processes including cell proliferation and morphogenesis. Decreased expression of this gene may play a role in colorectal cancer, and mutations in this gene are a cause of temtamy preaxial brachydactyly syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mice are viable, but display chondrodysplasia, brachydactyly and decreased bone density. Retinal degeneration, impaired motor strength, and hematological abnormalities are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Chsy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Chsy1 APN 7 66172126 missense possibly damaging 0.70
IGL01734:Chsy1 APN 7 66171310 missense probably damaging 0.98
IGL02037:Chsy1 APN 7 66171828 missense possibly damaging 0.69
IGL02797:Chsy1 APN 7 66171664 missense probably damaging 1.00
IGL02961:Chsy1 APN 7 66171782 missense probably benign 0.00
IGL03290:Chsy1 APN 7 66171031 missense probably benign 0.15
IGL03292:Chsy1 APN 7 66125372 missense probably benign 0.02
Chrysanthemum UTSW 7 66110229 critical splice donor site probably null
deprimido UTSW 7 66171687 missense probably damaging 1.00
Elevado UTSW 7 66110076 nonsense probably null
R0669:Chsy1 UTSW 7 66171687 missense probably damaging 1.00
R1336:Chsy1 UTSW 7 66125239 splice site probably null
R1499:Chsy1 UTSW 7 66172002 missense probably damaging 1.00
R1640:Chsy1 UTSW 7 66171514 missense probably benign 0.34
R1674:Chsy1 UTSW 7 66171663 missense probably damaging 1.00
R1812:Chsy1 UTSW 7 66171817 missense probably benign 0.12
R1934:Chsy1 UTSW 7 66172243 missense probably damaging 1.00
R2965:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2966:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R3692:Chsy1 UTSW 7 66171253 missense probably damaging 1.00
R4890:Chsy1 UTSW 7 66110226 missense probably benign 0.00
R5373:Chsy1 UTSW 7 66110076 nonsense probably null
R5936:Chsy1 UTSW 7 66172277 missense possibly damaging 0.89
R6149:Chsy1 UTSW 7 66125385 missense probably damaging 1.00
R6192:Chsy1 UTSW 7 66170877 missense probably benign 0.29
R6653:Chsy1 UTSW 7 66110193 missense probably benign 0.10
R6848:Chsy1 UTSW 7 66171037 missense probably damaging 1.00
R7318:Chsy1 UTSW 7 66110229 critical splice donor site probably null
R7514:Chsy1 UTSW 7 66172120 missense probably damaging 1.00
R7560:Chsy1 UTSW 7 66171244 missense possibly damaging 0.85
R7560:Chsy1 UTSW 7 66171571 missense probably damaging 1.00
R7655:Chsy1 UTSW 7 66171030 missense probably damaging 0.98
R7656:Chsy1 UTSW 7 66171030 missense probably damaging 0.98
X0012:Chsy1 UTSW 7 66172168 missense probably damaging 1.00
X0063:Chsy1 UTSW 7 66171924 missense probably benign 0.05
Z1176:Chsy1 UTSW 7 66172226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGCAGCAGATCTATTTCC -3'
(R):5'- TTCTAGCCACATTTCGGCCAG -3'

Sequencing Primer
(F):5'- GGGCAGCAGATCTATTTCCCAATC -3'
(R):5'- ATTTCGGCCAGCTGCTGC -3'
Posted On2014-12-29