Incidental Mutation 'R2964:Pth'
ID255974
Institutional Source Beutler Lab
Gene Symbol Pth
Ensembl Gene ENSMUSG00000059077
Gene Nameparathyroid hormone
Synonyms
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location113385580-113388570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113385929 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 79 (H79R)
Ref Sequence ENSEMBL: ENSMUSP00000078723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079793]
Predicted Effect probably benign
Transcript: ENSMUST00000079793
AA Change: H79R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078723
Gene: ENSMUSG00000059077
AA Change: H79R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PTH 30 65 7.55e-20 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the parathyroid family of proteins. The encoded preproprotein is proteolytically processed to generate a protein that binds to the parathyroid hormone/parathyroid hormone-related peptide receptor and regulates blood calcium and phosphate levels. Excess production of the encoded protein, known as hyperparathyroidism, can result in hypercalcemia and kidney stones. On the other hand, defective processing of the encoded protein may lead to hypoparathyroidism, which can result in hypocalcemia and numbness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit diminished cartilage mineralization, and reductions in angiopoietin-1, neovascularization, metaphyseal osteoblasts, and trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Pth
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2884:Pth UTSW 7 113386028 missense probably damaging 1.00
R2965:Pth UTSW 7 113385929 missense probably benign 0.00
R2966:Pth UTSW 7 113385929 missense probably benign 0.00
R4650:Pth UTSW 7 113385819 makesense probably null
R5240:Pth UTSW 7 113385844 missense probably damaging 1.00
R7606:Pth UTSW 7 113386243 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CTTCATAAGCTTGAAAAGGTAGCAG -3'
(R):5'- CCATTGTGCACAGGGAAGTG -3'

Sequencing Primer
(F):5'- TAGCAGCATATGTCAGTGCC -3'
(R):5'- TGCACAGGGAAGTGTGGACTC -3'
Posted On2014-12-29