Incidental Mutation 'R2964:Ing1'
ID255976
Institutional Source Beutler Lab
Gene Symbol Ing1
Ensembl Gene ENSMUSG00000045969
Gene Nameinhibitor of growth family, member 1
Synonyms2610028J21Rik, p33Ing1, mING1h
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location11555571-11563251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11561641 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 26 (S26R)
Ref Sequence ENSEMBL: ENSMUSP00000148248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054399] [ENSMUST00000209565] [ENSMUST00000209646] [ENSMUST00000210041] [ENSMUST00000210670] [ENSMUST00000210740] [ENSMUST00000211007]
Predicted Effect probably benign
Transcript: ENSMUST00000054399
AA Change: S120R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062593
Gene: ENSMUSG00000045969
AA Change: S120R

DomainStartEndE-ValueType
Pfam:ING 15 113 1.4e-33 PFAM
low complexity region 146 165 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
PHD 212 257 2.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209565
AA Change: S26R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000209646
AA Change: S26R

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000210041
AA Change: S26R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000210670
Predicted Effect probably benign
Transcript: ENSMUST00000210740
AA Change: S26R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000211007
AA Change: S26R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display a slight decrease in body weight, moderately impaired maternal nurturing, increased sensitivity to gamma-irradiation, and increased incidence of B-cell derived lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Ing1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ing1 APN 8 11561453 missense probably benign 0.33
F5770:Ing1 UTSW 8 11561934 missense probably damaging 1.00
R0422:Ing1 UTSW 8 11561933 missense probably damaging 0.98
R0546:Ing1 UTSW 8 11557031 missense probably damaging 1.00
R1295:Ing1 UTSW 8 11561501 missense probably benign 0.00
R1295:Ing1 UTSW 8 11561502 missense probably damaging 0.96
R1433:Ing1 UTSW 8 11557010 missense probably damaging 0.98
R1914:Ing1 UTSW 8 11561577 missense probably damaging 1.00
R2965:Ing1 UTSW 8 11561641 missense probably benign 0.09
R4559:Ing1 UTSW 8 11562090 missense probably benign 0.01
R6884:Ing1 UTSW 8 11561916 missense probably damaging 1.00
R7775:Ing1 UTSW 8 11561814 missense probably benign 0.00
R7778:Ing1 UTSW 8 11561814 missense probably benign 0.00
R7824:Ing1 UTSW 8 11561814 missense probably benign 0.00
V7583:Ing1 UTSW 8 11561934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGAGCTGGACGACTAC -3'
(R):5'- TTGCACAGACAGTACGTGGG -3'

Sequencing Primer
(F):5'- CTGGACGACTACTATGAGAAGTTC -3'
(R):5'- AGGAGACGCTTCCCTCTCTG -3'
Posted On2014-12-29