Incidental Mutation 'R2964:Fbxw21'
ID255977
Institutional Source Beutler Lab
Gene Symbol Fbxw21
Ensembl Gene ENSMUSG00000047237
Gene NameF-box and WD-40 domain protein 21
SynonymsE330009P21Rik
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109139447-109162041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109145510 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 314 (I314T)
Ref Sequence ENSEMBL: ENSMUSP00000143095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054925] [ENSMUST00000198076] [ENSMUST00000199540]
Predicted Effect probably benign
Transcript: ENSMUST00000054925
AA Change: I314T

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056358
Gene: ENSMUSG00000047237
AA Change: I314T

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 1e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197401
Predicted Effect probably benign
Transcript: ENSMUST00000198076
AA Change: I314T

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143095
Gene: ENSMUSG00000047237
AA Change: I314T

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 9e-8 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199540
SMART Domains Protein: ENSMUSP00000143200
Gene: ENSMUSG00000047237

DomainStartEndE-ValueType
FBOX 5 45 9e-9 SMART
Meta Mutation Damage Score 0.1002 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Fbxw21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Fbxw21 APN 9 109161964 missense probably damaging 1.00
IGL00901:Fbxw21 APN 9 109156399 missense probably benign 0.00
IGL01377:Fbxw21 APN 9 109146645 nonsense probably null
IGL01941:Fbxw21 APN 9 109148156 missense probably benign 0.07
IGL02491:Fbxw21 APN 9 109143819 missense probably benign
IGL03163:Fbxw21 APN 9 109145484 missense probably benign 0.01
IGL03377:Fbxw21 APN 9 109139529 missense probably benign 0.01
R0148:Fbxw21 UTSW 9 109148017 critical splice donor site probably null
R0328:Fbxw21 UTSW 9 109146585 missense possibly damaging 0.52
R0909:Fbxw21 UTSW 9 109156408 missense possibly damaging 0.84
R1506:Fbxw21 UTSW 9 109148189 missense probably damaging 1.00
R1575:Fbxw21 UTSW 9 109161916 missense probably benign 0.00
R1615:Fbxw21 UTSW 9 109143726 missense probably damaging 1.00
R1719:Fbxw21 UTSW 9 109148174 missense possibly damaging 0.85
R2415:Fbxw21 UTSW 9 109156401 missense possibly damaging 0.71
R2424:Fbxw21 UTSW 9 109157519 nonsense probably null
R2508:Fbxw21 UTSW 9 109145485 missense probably benign 0.31
R2898:Fbxw21 UTSW 9 109156336 missense possibly damaging 0.52
R2965:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R2966:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R4809:Fbxw21 UTSW 9 109143390 missense probably damaging 1.00
R4911:Fbxw21 UTSW 9 109145663 missense probably damaging 1.00
R5669:Fbxw21 UTSW 9 109145510 missense probably benign 0.12
R5928:Fbxw21 UTSW 9 109143825 missense possibly damaging 0.55
R6043:Fbxw21 UTSW 9 109145539 missense possibly damaging 0.69
R6277:Fbxw21 UTSW 9 109145555 missense possibly damaging 0.95
R6805:Fbxw21 UTSW 9 109157565 missense probably damaging 1.00
R6944:Fbxw21 UTSW 9 109157535 missense probably damaging 1.00
R7079:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R7081:Fbxw21 UTSW 9 109161922 missense probably damaging 1.00
R7744:Fbxw21 UTSW 9 109157652 missense possibly damaging 0.81
R7774:Fbxw21 UTSW 9 109143840 missense probably benign 0.00
R8043:Fbxw21 UTSW 9 109146626 missense probably benign 0.01
R8260:Fbxw21 UTSW 9 109146546 critical splice donor site probably null
Z1088:Fbxw21 UTSW 9 109145537 missense probably benign
Z1176:Fbxw21 UTSW 9 109145537 missense probably benign
Z1177:Fbxw21 UTSW 9 109145537 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGCGTGGGTGTATGCAC -3'
(R):5'- TGGACAATTCTCTCTGCAGGTG -3'

Sequencing Primer
(F):5'- GTGCACATGCTAAACCATCTTCTCAG -3'
(R):5'- CAGGTGTTTTACATGAGCAGCTTAC -3'
Posted On2014-12-29