Incidental Mutation 'R2964:Col13a1'
ID255980
Institutional Source Beutler Lab
Gene Symbol Col13a1
Ensembl Gene ENSMUSG00000058806
Gene Namecollagen, type XIII, alpha 1
Synonyms
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61838236-61979108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61961331 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 106 (R106W)
Ref Sequence ENSEMBL: ENSMUSP00000101094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105452] [ENSMUST00000105453] [ENSMUST00000105454]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051826
Predicted Effect probably damaging
Transcript: ENSMUST00000105452
AA Change: R106W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101092
Gene: ENSMUSG00000058806
AA Change: R106W

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
Pfam:Collagen 154 214 1.6e-12 PFAM
Pfam:Collagen 255 319 1.8e-10 PFAM
Pfam:Collagen 283 338 7.8e-11 PFAM
Pfam:Collagen 313 376 6.8e-10 PFAM
Pfam:Collagen 377 436 3e-10 PFAM
Pfam:Collagen 458 517 4.3e-12 PFAM
Pfam:Collagen 498 559 7.7e-12 PFAM
Pfam:Collagen 557 616 1.6e-11 PFAM
Pfam:Collagen 587 666 9.8e-8 PFAM
Pfam:Collagen 635 704 4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105453
AA Change: R106W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101093
Gene: ENSMUSG00000058806
AA Change: R106W

DomainStartEndE-ValueType
internal_repeat_5 17 30 7.25e-5 PROSPERO
low complexity region 41 59 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
internal_repeat_5 140 153 7.25e-5 PROSPERO
Pfam:Collagen 154 214 1.5e-12 PFAM
Pfam:Collagen 235 296 1e-10 PFAM
internal_repeat_2 297 328 1.33e-8 PROSPERO
internal_repeat_1 297 332 1.43e-12 PROSPERO
Pfam:Collagen 355 414 2.8e-10 PFAM
Pfam:Collagen 436 495 4.6e-12 PFAM
Pfam:Collagen 477 551 3.6e-8 PFAM
Pfam:Collagen 536 606 5.1e-10 PFAM
Pfam:Collagen 574 670 1.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105454
AA Change: R106W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101094
Gene: ENSMUSG00000058806
AA Change: R106W

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
Pfam:Collagen 112 161 6.7e-9 PFAM
Pfam:Collagen 164 223 1.5e-11 PFAM
Pfam:Collagen 264 328 6.7e-10 PFAM
Pfam:Collagen 292 347 2.8e-10 PFAM
Pfam:Collagen 322 385 2.3e-9 PFAM
Pfam:Collagen 386 445 1.1e-9 PFAM
Pfam:Collagen 467 526 1.6e-11 PFAM
Pfam:Collagen 507 582 4.8e-9 PFAM
Pfam:Collagen 564 630 5.4e-9 PFAM
low complexity region 671 695 N/A INTRINSIC
internal_repeat_2 698 723 7.38e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218711
Meta Mutation Damage Score 0.1694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of one of the nonfibrillar collagens. The function of this gene product is not known, however, it has been detected at low levels in all connective tissue-producing cells so it may serve a general function in connective tissues. Unlike most of the collagens, which are secreted into the extracellular matrix, collagen XIII contains a transmembrane domain and the protein has been localized to the plasma membrane. The transcripts for this gene undergo complex and extensive splicing involving at least eight exons. Like other collagens, collagen XIII is a trimer; it is not known whether this trimer is composed of one or more than one alpha chain isomer. A number of alternatively spliced transcript variants have been described, but the full length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the transmembrane exhibit small muscle fibers and are susceptible to excerise-induced muscle damage and muscle inflammation. Mice homozygous for a knock-out allele exhibit tremors and abnormal neuromuscular junction morphology and endplate potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Col13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Col13a1 APN 10 61864005 critical splice acceptor site probably null
IGL00936:Col13a1 APN 10 61876290 missense probably damaging 0.99
IGL00963:Col13a1 APN 10 61838697 utr 3 prime probably benign
IGL01801:Col13a1 APN 10 61843614 missense probably damaging 1.00
IGL02247:Col13a1 APN 10 61961345 missense probably damaging 1.00
IGL02296:Col13a1 APN 10 61862025 intron probably benign
IGL02430:Col13a1 APN 10 61874751 missense probably benign 0.26
IGL02884:Col13a1 APN 10 61905285 splice site probably benign
IGL03036:Col13a1 APN 10 61893913 critical splice donor site probably null
IGL03145:Col13a1 APN 10 61891261 missense probably benign 0.07
IGL03392:Col13a1 APN 10 61885711 missense possibly damaging 0.88
R0027:Col13a1 UTSW 10 61850161 missense unknown
R0440:Col13a1 UTSW 10 61867483 missense possibly damaging 0.85
R0518:Col13a1 UTSW 10 61862746 missense unknown
R0521:Col13a1 UTSW 10 61862746 missense unknown
R0631:Col13a1 UTSW 10 61887350 nonsense probably null
R1311:Col13a1 UTSW 10 61864010 splice site probably benign
R1350:Col13a1 UTSW 10 61894069 splice site probably benign
R1572:Col13a1 UTSW 10 61866426 unclassified probably null
R2401:Col13a1 UTSW 10 61851162 missense unknown
R2883:Col13a1 UTSW 10 61978356 missense probably benign 0.23
R2906:Col13a1 UTSW 10 61860488 intron probably benign
R2965:Col13a1 UTSW 10 61961331 missense probably damaging 1.00
R3703:Col13a1 UTSW 10 61867829 critical splice donor site probably null
R3704:Col13a1 UTSW 10 61867829 critical splice donor site probably null
R3844:Col13a1 UTSW 10 61850209 missense unknown
R3928:Col13a1 UTSW 10 61867525 unclassified probably benign
R3939:Col13a1 UTSW 10 61863082 missense unknown
R4327:Col13a1 UTSW 10 61863979 missense unknown
R4328:Col13a1 UTSW 10 61863979 missense unknown
R4329:Col13a1 UTSW 10 61863979 missense unknown
R4585:Col13a1 UTSW 10 61887245 splice site probably null
R4705:Col13a1 UTSW 10 61850165 missense unknown
R4864:Col13a1 UTSW 10 61862660 missense unknown
R5072:Col13a1 UTSW 10 61874018 splice site silent
R5074:Col13a1 UTSW 10 61874018 splice site silent
R5114:Col13a1 UTSW 10 61890101 missense possibly damaging 0.82
R5625:Col13a1 UTSW 10 61843609 missense unknown
R5664:Col13a1 UTSW 10 61851116 missense probably damaging 1.00
R5799:Col13a1 UTSW 10 61849140 intron probably benign
Z1177:Col13a1 UTSW 10 61905262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAATGGTGGATGGTGCATG -3'
(R):5'- AGAGCCGTTCGAAGGCTATC -3'

Sequencing Primer
(F):5'- AGCTGCATCCACAGGAAGCTG -3'
(R):5'- CGAAGGCTATCAGGACTGTTC -3'
Posted On2014-12-29