Incidental Mutation 'R2964:Fstl3'
ID255981
Institutional Source Beutler Lab
Gene Symbol Fstl3
Ensembl Gene ENSMUSG00000020325
Gene Namefollistatin-like 3
SynonymsFlrg, E030038F23Rik
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2964 (G1)
Quality Score199
Status Validated
Chromosome10
Chromosomal Location79777272-79782630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79781223 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 200 (V200A)
Ref Sequence ENSEMBL: ENSMUSP00000020575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020573] [ENSMUST00000020575] [ENSMUST00000169684]
Predicted Effect probably benign
Transcript: ENSMUST00000020573
SMART Domains Protein: ENSMUSP00000020573
Gene: ENSMUSG00000020323

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Tryp_SPc 39 264 1.53e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020575
AA Change: V200A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020575
Gene: ENSMUSG00000020325
AA Change: V200A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FOLN 96 118 4.13e-6 SMART
KAZAL 116 165 1.69e-11 SMART
FOLN 168 191 1.09e-5 SMART
KAZAL 197 241 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167987
SMART Domains Protein: ENSMUSP00000130448
Gene: ENSMUSG00000020323

DomainStartEndE-ValueType
Pfam:Trypsin 1 75 1.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168798
Predicted Effect probably benign
Transcript: ENSMUST00000169684
SMART Domains Protein: ENSMUSP00000132215
Gene: ENSMUSG00000020323

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Tryp_SPc 39 264 1.53e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170380
Predicted Effect probably benign
Transcript: ENSMUST00000171681
SMART Domains Protein: ENSMUSP00000131642
Gene: ENSMUSG00000020323

DomainStartEndE-ValueType
Tryp_SPc 1 87 3.16e-1 SMART
Meta Mutation Damage Score 0.1120 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Follistatin-like 3 is a secreted glycoprotein of the follistatin-module-protein family. It may have a role in leukemogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Adult mice homozygous for a knock-out allele display increased pancreatic islet number and size, beta cell hyperplasia, hepatic steatosis, increased heart weight, mild hypertension, and alterations in glucose homeostasis and fat distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Fstl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02680:Fstl3 APN 10 79778672 nonsense probably null
IGL03165:Fstl3 APN 10 79779965 missense probably benign 0.02
R0382:Fstl3 UTSW 10 79777307 missense probably benign
R2113:Fstl3 UTSW 10 79781178 missense probably damaging 0.96
R2965:Fstl3 UTSW 10 79781223 missense probably benign
R2966:Fstl3 UTSW 10 79781223 missense probably benign
R5211:Fstl3 UTSW 10 79780178 missense probably benign 0.01
R6225:Fstl3 UTSW 10 79780009 missense probably benign 0.08
R7389:Fstl3 UTSW 10 79780031 missense probably damaging 1.00
R7390:Fstl3 UTSW 10 79780031 missense probably damaging 1.00
R7484:Fstl3 UTSW 10 79780031 missense probably damaging 1.00
T0722:Fstl3 UTSW 10 79780163 missense probably damaging 1.00
X0003:Fstl3 UTSW 10 79780163 missense probably damaging 1.00
X0022:Fstl3 UTSW 10 79780067 missense probably benign 0.06
Z1176:Fstl3 UTSW 10 79781198 missense probably benign
Z1177:Fstl3 UTSW 10 79780108 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATCTTGACAGCAGGGTGG -3'
(R):5'- ACTTTGGGGCCACCTACAAG -3'

Sequencing Primer
(F):5'- TAGTGTCCCAGGGCAGG -3'
(R):5'- TTGGGGCCACCTACAAGTATGG -3'
Posted On2014-12-29