Incidental Mutation 'R2964:Chrna2'
ID255985
Institutional Source Beutler Lab
Gene Symbol Chrna2
Ensembl Gene ENSMUSG00000022041
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)
SynonymsAcra-2, Acra2
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66135039-66152948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66149368 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 321 (V321A)
Ref Sequence ENSEMBL: ENSMUSP00000145896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022620] [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730] [ENSMUST00000206455]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022620
AA Change: V321A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022620
Gene: ENSMUSG00000022041
AA Change: V321A

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 36 242 2.2e-81 PFAM
Pfam:Neur_chan_memb 249 503 5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022622
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089250
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111121
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136216
Predicted Effect probably benign
Transcript: ENSMUST00000154865
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178730
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206455
AA Change: V321A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.3466 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinic acetylcholine receptors (nAChRs) are ligand-gated ion channels formed by a pentameric arrangement of alpha and beta subunits to create distinct muscle and neuronal receptors. Neuronal receptors are found throughout the peripheral and central nervous system where they are involved in fast synaptic transmission. This gene encodes an alpha subunit that is widely expressed in the brain. The proposed structure for nAChR subunits is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. Mutations in this gene cause autosomal dominant nocturnal frontal lobe epilepsy type 4. Single nucleotide polymorphisms (SNPs) in this gene have been associated with nicotine dependence. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Chrna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Chrna2 APN 14 66149440 missense probably benign 0.01
IGL03172:Chrna2 APN 14 66142239 missense probably benign
IGL03268:Chrna2 APN 14 66150946 splice site probably benign
IGL03344:Chrna2 APN 14 66150966 missense probably damaging 0.99
intrepid UTSW 14 66146453 missense probably damaging 1.00
PIT1430001:Chrna2 UTSW 14 66149737 missense probably benign 0.01
R0511:Chrna2 UTSW 14 66149104 missense probably damaging 1.00
R0631:Chrna2 UTSW 14 66149308 missense probably benign 0.45
R1205:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1485:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1487:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1513:Chrna2 UTSW 14 66143429 missense probably benign 0.13
R2023:Chrna2 UTSW 14 66142228 missense probably benign 0.25
R2094:Chrna2 UTSW 14 66149463 missense possibly damaging 0.65
R2966:Chrna2 UTSW 14 66149368 missense possibly damaging 0.82
R3118:Chrna2 UTSW 14 66150993 missense probably damaging 0.98
R3931:Chrna2 UTSW 14 66149767 missense probably benign 0.26
R3979:Chrna2 UTSW 14 66148953 missense probably damaging 1.00
R3983:Chrna2 UTSW 14 66149457 missense probably benign 0.00
R4080:Chrna2 UTSW 14 66143417 missense probably benign 0.12
R4080:Chrna2 UTSW 14 66143424 nonsense probably null
R4508:Chrna2 UTSW 14 66146453 missense probably damaging 1.00
R4661:Chrna2 UTSW 14 66148843 missense probably damaging 1.00
R4726:Chrna2 UTSW 14 66148896 missense possibly damaging 0.85
R5349:Chrna2 UTSW 14 66143507 missense probably damaging 0.99
R5787:Chrna2 UTSW 14 66149008 missense probably benign 0.16
R6967:Chrna2 UTSW 14 66150949 critical splice acceptor site probably null
R7218:Chrna2 UTSW 14 66143871 intron probably null
R7274:Chrna2 UTSW 14 66149226 missense probably benign 0.03
R7565:Chrna2 UTSW 14 66151035 missense probably benign
Z1176:Chrna2 UTSW 14 66149304 missense probably damaging 1.00
Z1177:Chrna2 UTSW 14 66151027 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACTACTTCGTTATCCGCCGG -3'
(R):5'- ATGATAAGTGGGGCTGAGCTTC -3'

Sequencing Primer
(F):5'- GGCTGCCGCTGTTCTACAC -3'
(R):5'- TTCAGACCTGGAGAGCCATG -3'
Posted On2014-12-29