Incidental Mutation 'R2964:Hrh4'
ID255990
Institutional Source Beutler Lab
Gene Symbol Hrh4
Ensembl Gene ENSMUSG00000037346
Gene Namehistamine receptor H4
SynonymsH4R
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location13006990-13022882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13022369 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 322 (C322R)
Ref Sequence ENSEMBL: ENSMUSP00000041061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041676]
Predicted Effect probably benign
Transcript: ENSMUST00000041676
AA Change: C322R

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041061
Gene: ENSMUSG00000037346
AA Change: C322R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 26 211 1e-5 PFAM
Pfam:7tm_1 32 360 8.1e-58 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by a family of histamine receptors, which are a subset of the G-protein coupled receptor superfamily. This gene encodes a histamine receptor that is predominantly expressed in haematopoietic cells. The protein is thought to play a role in inflammation and allergy reponses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased allergic response to airway inflammation and decreased Th2 responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Hrh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Hrh4 APN 18 13015947 splice site probably benign
IGL01544:Hrh4 APN 18 13015893 missense probably benign 0.22
IGL01765:Hrh4 APN 18 13007195 missense probably damaging 1.00
IGL02117:Hrh4 APN 18 13022420 missense probably benign 0.02
IGL02559:Hrh4 APN 18 13007244 critical splice donor site probably null
IGL03277:Hrh4 APN 18 13015883 missense probably damaging 1.00
IGL03281:Hrh4 APN 18 13022469 missense possibly damaging 0.94
BB009:Hrh4 UTSW 18 13015812 nonsense probably null
BB019:Hrh4 UTSW 18 13015812 nonsense probably null
R0267:Hrh4 UTSW 18 13022398 nonsense probably null
R0329:Hrh4 UTSW 18 13007245 splice site probably benign
R1601:Hrh4 UTSW 18 13015898 missense possibly damaging 0.86
R1827:Hrh4 UTSW 18 13022204 missense probably damaging 0.97
R3843:Hrh4 UTSW 18 13022286 missense possibly damaging 0.77
R5262:Hrh4 UTSW 18 13015813 missense probably damaging 0.99
R5325:Hrh4 UTSW 18 13021997 nonsense probably null
R5473:Hrh4 UTSW 18 13021928 missense probably benign 0.34
R6500:Hrh4 UTSW 18 13022468 missense probably damaging 0.98
R6622:Hrh4 UTSW 18 13022397 missense probably damaging 1.00
R7574:Hrh4 UTSW 18 13021913 missense possibly damaging 0.92
R7877:Hrh4 UTSW 18 13022525 missense possibly damaging 0.50
R7960:Hrh4 UTSW 18 13022525 missense possibly damaging 0.50
R8197:Hrh4 UTSW 18 13021929 missense probably damaging 1.00
R8278:Hrh4 UTSW 18 13007227 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCGAAGAAAGAGCAGCATCCTG -3'
(R):5'- ACTGACTGGTTCTGTGACAGC -3'

Sequencing Primer
(F):5'- CAGCATCCTGGTGTCCTTAAGG -3'
(R):5'- CTGTGACAGCGCTGGTTGC -3'
Posted On2014-12-29