Incidental Mutation 'R2964:Olfr1453'
ID255992
Institutional Source Beutler Lab
Gene Symbol Olfr1453
Ensembl Gene ENSMUSG00000094755
Gene Nameolfactory receptor 1453
SynonymsMOR202-6, GA_x6K02T2RE5P-3357666-3356743
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13027404-13028327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13028048 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 94 (A94T)
Ref Sequence ENSEMBL: ENSMUSP00000085071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087773]
Predicted Effect probably benign
Transcript: ENSMUST00000087773
AA Change: A94T

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085071
Gene: ENSMUSG00000094755
AA Change: A94T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.6e-50 PFAM
Pfam:7tm_1 39 288 2.6e-20 PFAM
Meta Mutation Damage Score 0.2759 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Olfr1453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Olfr1453 APN 19 13027591 missense probably damaging 0.98
IGL01137:Olfr1453 APN 19 13028030 missense possibly damaging 0.52
IGL01894:Olfr1453 APN 19 13028285 missense probably damaging 1.00
IGL02579:Olfr1453 APN 19 13027528 missense probably damaging 0.99
PIT4418001:Olfr1453 UTSW 19 13027731 nonsense probably null
R0099:Olfr1453 UTSW 19 13027801 missense probably damaging 1.00
R0211:Olfr1453 UTSW 19 13028282 missense possibly damaging 0.95
R0211:Olfr1453 UTSW 19 13028282 missense possibly damaging 0.95
R0395:Olfr1453 UTSW 19 13028299 missense probably damaging 1.00
R0453:Olfr1453 UTSW 19 13027931 missense probably damaging 0.97
R0847:Olfr1453 UTSW 19 13027731 nonsense probably null
R1227:Olfr1453 UTSW 19 13027853 missense probably benign
R1823:Olfr1453 UTSW 19 13027817 missense probably benign 0.06
R2509:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R2899:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R2965:Olfr1453 UTSW 19 13028048 missense probably benign 0.38
R3157:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3158:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3409:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3410:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3411:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3425:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R4018:Olfr1453 UTSW 19 13027825 missense probably benign
R4668:Olfr1453 UTSW 19 13028081 missense probably benign 0.00
R4805:Olfr1453 UTSW 19 13028297 missense probably benign 0.04
R5180:Olfr1453 UTSW 19 13027412 missense probably benign 0.01
R5391:Olfr1453 UTSW 19 13027786 missense probably damaging 1.00
R5557:Olfr1453 UTSW 19 13027640 missense probably benign 0.01
R5740:Olfr1453 UTSW 19 13027562 missense probably benign 0.24
R7472:Olfr1453 UTSW 19 13028075 missense probably benign
R7832:Olfr1453 UTSW 19 13027996 missense probably benign 0.02
R8044:Olfr1453 UTSW 19 13027465 missense probably damaging 1.00
R8229:Olfr1453 UTSW 19 13028197 missense possibly damaging 0.55
Z1088:Olfr1453 UTSW 19 13028027 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCACAGAAGGAGAGACTTAATGC -3'
(R):5'- CACCCTTATAGGAAATCTTGGGC -3'

Sequencing Primer
(F):5'- AGGAGAGACTTAATGCATCCATAG -3'
(R):5'- CCCTTATAGGAAATCTTGGGCTGATC -3'
Posted On2014-12-29