Incidental Mutation 'R2965:Gpr45'
ID255994
Institutional Source Beutler Lab
Gene Symbol Gpr45
Ensembl Gene ENSMUSG00000041907
Gene NameG protein-coupled receptor 45
SynonymsPSP24alpha, 9230112G11Rik
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location42952872-43035456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43032508 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 104 (D104N)
Ref Sequence ENSEMBL: ENSMUSP00000135986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114761] [ENSMUST00000179766]
AlphaFold Q9EQQ4
Predicted Effect possibly damaging
Transcript: ENSMUST00000114761
AA Change: D104N

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110409
Gene: ENSMUSG00000041907
AA Change: D104N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 42 188 5.5e-9 PFAM
Pfam:7TM_GPCR_Srsx 45 340 1.9e-7 PFAM
Pfam:7tm_1 51 325 2.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179655
SMART Domains Protein: ENSMUSP00000136725
Gene: ENSMUSG00000096364

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179766
AA Change: D104N

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135986
Gene: ENSMUSG00000041907
AA Change: D104N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 42 189 7.1e-9 PFAM
Pfam:7TM_GPCR_Srsx 45 340 1.9e-7 PFAM
Pfam:7tm_1 51 325 2.1e-51 PFAM
Meta Mutation Damage Score 0.1556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the G protein-coupled receptor (GPCR) family. Members of this protein family contain seven putative transmembrane domains and may mediate signaling processes to the interior of the cell via activation of heterotrimeric G proteins. This protein may function in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Ankar T C 1: 72,675,820 I382V probably benign Het
Anks1 A G 17: 28,053,905 T925A probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fam187b A C 7: 30,977,729 D221A probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Ssrp1 A G 2: 85,041,586 T385A possibly damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in Gpr45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Gpr45 APN 1 43032292 missense possibly damaging 0.77
IGL01528:Gpr45 APN 1 43033223 missense probably benign 0.00
IGL01833:Gpr45 APN 1 43032242 missense probably benign
IGL02034:Gpr45 APN 1 43033318 makesense probably null
IGL02230:Gpr45 APN 1 43032656 missense probably damaging 1.00
IGL02279:Gpr45 APN 1 43032838 missense probably damaging 0.96
IGL02394:Gpr45 APN 1 43030112 intron probably benign
IGL02795:Gpr45 APN 1 43032493 missense possibly damaging 0.82
IGL02902:Gpr45 APN 1 43033211 missense possibly damaging 0.67
IGL03017:Gpr45 APN 1 43032356 missense possibly damaging 0.95
expansive UTSW 1 43032838 missense probably damaging 0.96
extensive UTSW 1 43033058 missense probably damaging 1.00
R0368:Gpr45 UTSW 1 43033016 missense probably damaging 1.00
R2964:Gpr45 UTSW 1 43032508 missense possibly damaging 0.87
R2966:Gpr45 UTSW 1 43032508 missense possibly damaging 0.87
R4551:Gpr45 UTSW 1 43032790 missense probably benign 0.00
R4681:Gpr45 UTSW 1 43032908 missense probably benign 0.00
R4821:Gpr45 UTSW 1 43030453 intron probably benign
R4966:Gpr45 UTSW 1 43033120 missense probably benign 0.00
R5054:Gpr45 UTSW 1 43032649 missense probably benign 0.38
R5319:Gpr45 UTSW 1 43032838 missense probably damaging 0.96
R5667:Gpr45 UTSW 1 43033058 missense probably damaging 1.00
R5671:Gpr45 UTSW 1 43033058 missense probably damaging 1.00
R7250:Gpr45 UTSW 1 43032371 missense probably damaging 1.00
R8117:Gpr45 UTSW 1 43033315 missense probably damaging 1.00
R8393:Gpr45 UTSW 1 43032235 missense probably benign 0.00
R8752:Gpr45 UTSW 1 43032682 missense possibly damaging 0.94
R8927:Gpr45 UTSW 1 43033154 missense probably damaging 0.98
R8928:Gpr45 UTSW 1 43033154 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCAATAATGATGCTGCTGATG -3'
(R):5'- ATGAACGTCCAGCCAGTGAAG -3'

Sequencing Primer
(F):5'- CAATAATGATGCTGCTGATGATCGTG -3'
(R):5'- TCCAGCCAGTGAAGGAGGG -3'
Posted On2014-12-29