Mutagenetix > Incidental Mutations

Incidental Mutation 'R2965:Cep250'

256003

Institutional Source

Beutler Lab

Gene Symbol

Cep250

Ensembl Gene

ENSMUSG00000038241

Gene Name

centrosomal protein 250

Synonyms

Cep2, Inmp, B230210E21Rik

MMRRC Submission

040521-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

155956458-155998900 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 155994878 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 2256 (K2256E)

Ref Sequence

ENSEMBL: ENSMUSP00000105248 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000128683]

Predicted Effect

probably benign
Transcript: ENSMUST00000039994
AA Change: K2255E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: K2255E

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	4.2e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	327	N/A	INTRINSIC
internal_repeat_1	444	460	1.47e-18	PROSPERO
internal_repeat_1	465	481	1.47e-18	PROSPERO
low complexity region	495	506	N/A	INTRINSIC
low complexity region	557	580	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	635	650	N/A	INTRINSIC
low complexity region	669	677	N/A	INTRINSIC
low complexity region	688	703	N/A	INTRINSIC
low complexity region	708	719	N/A	INTRINSIC
low complexity region	896	914	N/A	INTRINSIC
low complexity region	990	1007	N/A	INTRINSIC
low complexity region	1043	1053	N/A	INTRINSIC
low complexity region	1138	1143	N/A	INTRINSIC
low complexity region	1182	1195	N/A	INTRINSIC
coiled coil region	1257	1687	N/A	INTRINSIC
low complexity region	1872	1895	N/A	INTRINSIC
low complexity region	1919	1933	N/A	INTRINSIC
low complexity region	1941	1960	N/A	INTRINSIC
internal_repeat_2	2002	2052	3.9e-6	PROSPERO
coiled coil region	2068	2169	N/A	INTRINSIC
coiled coil region	2196	2217	N/A	INTRINSIC
coiled coil region	2251	2310	N/A	INTRINSIC
low complexity region	2325	2338	N/A	INTRINSIC
coiled coil region	2340	2366	N/A	INTRINSIC
low complexity region	2379	2388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000094421
AA Change: K2235E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: K2235E

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	5.4e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
coiled coil region	400	1165	N/A	INTRINSIC
coiled coil region	1237	1667	N/A	INTRINSIC
low complexity region	1852	1875	N/A	INTRINSIC
low complexity region	1899	1913	N/A	INTRINSIC
low complexity region	1921	1940	N/A	INTRINSIC
internal_repeat_1	1982	2032	3.35e-6	PROSPERO
coiled coil region	2048	2149	N/A	INTRINSIC
coiled coil region	2176	2197	N/A	INTRINSIC
coiled coil region	2231	2290	N/A	INTRINSIC
low complexity region	2305	2318	N/A	INTRINSIC
coiled coil region	2320	2346	N/A	INTRINSIC
low complexity region	2359	2368	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109619
AA Change: K2256E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: K2256E

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	214	4.1e-60	PFAM
low complexity region	215	225	N/A	INTRINSIC
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
internal_repeat_1	445	461	1.51e-18	PROSPERO
internal_repeat_1	466	482	1.51e-18	PROSPERO
low complexity region	496	507	N/A	INTRINSIC
low complexity region	558	581	N/A	INTRINSIC
low complexity region	584	596	N/A	INTRINSIC
low complexity region	636	651	N/A	INTRINSIC
low complexity region	670	678	N/A	INTRINSIC
low complexity region	689	704	N/A	INTRINSIC
low complexity region	709	720	N/A	INTRINSIC
low complexity region	897	915	N/A	INTRINSIC
low complexity region	991	1008	N/A	INTRINSIC
low complexity region	1044	1054	N/A	INTRINSIC
low complexity region	1139	1144	N/A	INTRINSIC
low complexity region	1183	1196	N/A	INTRINSIC
coiled coil region	1258	1688	N/A	INTRINSIC
low complexity region	1873	1896	N/A	INTRINSIC
low complexity region	1920	1934	N/A	INTRINSIC
low complexity region	1942	1961	N/A	INTRINSIC
internal_repeat_2	2003	2053	3.95e-6	PROSPERO
coiled coil region	2069	2170	N/A	INTRINSIC
coiled coil region	2197	2218	N/A	INTRINSIC
coiled coil region	2252	2311	N/A	INTRINSIC
low complexity region	2326	2339	N/A	INTRINSIC
coiled coil region	2341	2367	N/A	INTRINSIC
low complexity region	2380	2389	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124812

Predicted Effect

probably benign
Transcript: ENSMUST00000128683

SMART Domains

Protein: ENSMUSP00000119845
Gene: ENSMUSG00000038241

Domain	Start	End	E-Value	Type
coiled coil region	2	37	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148191

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	C	T	7: 41,626,405	R511*	probably null	Het
4930430A15Rik	A	T	2: 111,204,019	S359T	possibly damaging	Het
Add1	C	A	5: 34,630,714	D702E	probably benign	Het
Aff3	A	G	1: 38,209,710	I772T	probably damaging	Het
Ankar	T	C	1: 72,675,820	I382V	probably benign	Het
Anks1	A	G	17: 28,053,905	T925A	probably benign	Het
Asprv1	T	A	6: 86,628,366	C65S	probably damaging	Het
Atp8a1	T	C	5: 67,647,706	D1022G	probably benign	Het
Chsy1	G	A	7: 66,172,164	G716R	probably damaging	Het
Cntln	T	C	4: 84,974,027		probably null	Het
Col13a1	G	A	10: 61,961,331	R106W	probably damaging	Het
Col2a1	A	G	15: 97,976,095	I1402T	unknown	Het
Col4a3	T	C	1: 82,648,600	L86P	unknown	Het
Cul9	A	G	17: 46,502,228	V2355A	probably damaging	Het
Ddx43	C	A	9: 78,406,379	Y197*	probably null	Het
Dnah7b	T	A	1: 46,207,572	I1636N	probably damaging	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Dyrk2	T	A	10: 118,860,337	K339*	probably null	Het
Fam187b	A	C	7: 30,977,729	D221A	probably benign	Het
Fbxw21	A	G	9: 109,145,510	I314T	probably benign	Het
Fgd6	T	A	10: 94,044,194	F303L	probably benign	Het
Fstl3	T	C	10: 79,781,223	V200A	probably benign	Het
Gm10784	A	T	13: 49,945,197		noncoding transcript	Het
Gpr45	G	A	1: 43,032,508	D104N	possibly damaging	Het
Gria1	C	T	11: 57,185,801	Q8*	probably null	Het
H2-T22	A	G	17: 36,040,645	L231S	probably damaging	Het
Ice1	A	T	13: 70,602,578	D1796E	probably benign	Het
Ing1	T	A	8: 11,561,641	S26R	probably benign	Het
Klhl2	C	T	8: 64,752,760	V376M	probably benign	Het
Lrriq1	A	G	10: 103,214,900	S664P	probably benign	Het
Ltf	G	T	9: 111,028,472	C443F	possibly damaging	Het
Mgam	T	C	6: 40,768,220	V1807A	possibly damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Mycbp2	A	G	14: 103,297,358	V304A	probably benign	Het
Nek10	T	C	14: 14,836,202	L141P	probably damaging	Het
Noa1	T	C	5: 77,306,344	E483G	possibly damaging	Het
Olfr1453	C	T	19: 13,028,048	A94T	probably benign	Het
Pkd1l1	T	A	11: 8,874,236	S1110C	probably damaging	Het
Ppp4r4	T	C	12: 103,612,821	S873P	probably damaging	Het
Prss35	A	G	9: 86,755,582	D135G	probably damaging	Het
Pth	T	C	7: 113,385,929	H79R	probably benign	Het
Rab21	T	C	10: 115,294,909	N164S	probably benign	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Het
Slc4a5	C	T	6: 83,296,669	T997I	probably damaging	Het
Ssrp1	A	G	2: 85,041,586	T385A	possibly damaging	Het
Tcf15	T	C	2: 152,143,951	I109T	probably damaging	Het
Tcp11	C	A	17: 28,069,265	D330Y	probably benign	Het
Tktl2	T	A	8: 66,512,063	V91E	probably benign	Het
Usp48	G	A	4: 137,613,762	V358M	probably damaging	Het
Vmn1r228	A	G	17: 20,776,347	I303T	probably damaging	Het
Zfp229	T	G	17: 21,746,029	H413Q	probably damaging	Het

Other mutations in Cep250

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Cep250	APN	2	155991329	missense	probably benign	0.00
IGL01077:Cep250	APN	2	155962134	missense	probably damaging	1.00
IGL01084:Cep250	APN	2	155998393	missense	probably benign	0.00
IGL01400:Cep250	APN	2	155998291	missense	possibly damaging	0.78
IGL01570:Cep250	APN	2	155967663	splice site	probably benign
IGL01583:Cep250	APN	2	155976149	missense	probably damaging	0.99
IGL01590:Cep250	APN	2	155992317	missense	possibly damaging	0.80
IGL01647:Cep250	APN	2	155983376	missense	probably benign	0.02
IGL01959:Cep250	APN	2	155983359	missense	possibly damaging	0.63
IGL02066:Cep250	APN	2	155976521	missense	probably damaging	1.00
IGL02219:Cep250	APN	2	155991594	missense	probably benign	0.26
IGL02322:Cep250	APN	2	155990328	missense	probably damaging	1.00
IGL02728:Cep250	APN	2	155983278	unclassified	probably benign
IGL02955:Cep250	APN	2	155975756	missense	probably benign	0.01
IGL03369:Cep250	APN	2	155990271	missense	probably benign	0.00
R0366:Cep250	UTSW	2	155988401	missense	probably benign	0.00
R0403:Cep250	UTSW	2	155992349	missense	probably damaging	0.99
R0441:Cep250	UTSW	2	155972004	missense	possibly damaging	0.82
R0482:Cep250	UTSW	2	155964974	splice site	probably benign
R0507:Cep250	UTSW	2	155992532	missense	possibly damaging	0.60
R0614:Cep250	UTSW	2	155970097	nonsense	probably null
R0855:Cep250	UTSW	2	155964111	missense	probably damaging	1.00
R0973:Cep250	UTSW	2	155964289	splice site	probably benign
R1137:Cep250	UTSW	2	155990840	missense	probably benign	0.05
R1270:Cep250	UTSW	2	155990681	missense	probably benign	0.01
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1703:Cep250	UTSW	2	155965546	missense	probably benign	0.23
R1705:Cep250	UTSW	2	155963786	missense	probably damaging	1.00
R1740:Cep250	UTSW	2	155973356	missense	probably damaging	0.99
R1796:Cep250	UTSW	2	155992187	missense	possibly damaging	0.88
R1897:Cep250	UTSW	2	155976095	missense	probably damaging	1.00
R1900:Cep250	UTSW	2	155985374	critical splice donor site	probably null
R1958:Cep250	UTSW	2	155976381	splice site	probably null
R1974:Cep250	UTSW	2	155989504	missense	probably damaging	0.96
R2015:Cep250	UTSW	2	155981453	missense	probably damaging	0.96
R2033:Cep250	UTSW	2	155970892	missense	probably damaging	0.99
R2224:Cep250	UTSW	2	155991817	missense	possibly damaging	0.94
R2266:Cep250	UTSW	2	155976170	missense	probably benign	0.13
R2278:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2332:Cep250	UTSW	2	155990607	missense	probably damaging	1.00
R2364:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2366:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2367:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2385:Cep250	UTSW	2	155974341	missense	probably damaging	1.00
R2830:Cep250	UTSW	2	155983316	missense	probably benign	0.00
R2895:Cep250	UTSW	2	155992122	missense	probably benign	0.00
R2966:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R3016:Cep250	UTSW	2	155991288	missense	probably damaging	1.00
R3052:Cep250	UTSW	2	155991048	missense	probably damaging	0.99
R3424:Cep250	UTSW	2	155981461	missense	probably benign	0.02
R3930:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4085:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4087:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4088:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4090:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4110:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4355:Cep250	UTSW	2	155991525	missense	probably damaging	1.00
R4601:Cep250	UTSW	2	155962053	missense	probably benign	0.10
R4721:Cep250	UTSW	2	155970199	missense	probably damaging	1.00
R4995:Cep250	UTSW	2	155988316	missense	probably damaging	1.00
R5053:Cep250	UTSW	2	155962928	missense	possibly damaging	0.77
R5090:Cep250	UTSW	2	155976404	missense	probably damaging	1.00
R5744:Cep250	UTSW	2	155981474	missense	possibly damaging	0.60
R5775:Cep250	UTSW	2	155969374	missense	possibly damaging	0.92
R5986:Cep250	UTSW	2	155979277	missense	probably damaging	1.00
R6112:Cep250	UTSW	2	155994583	missense	possibly damaging	0.95
R6152:Cep250	UTSW	2	155981438	missense	possibly damaging	0.94
R6823:Cep250	UTSW	2	155981459	missense	probably benign	0.02
R6859:Cep250	UTSW	2	155992526	missense	probably benign	0.24
R6900:Cep250	UTSW	2	155996270	critical splice acceptor site	probably null
R7107:Cep250	UTSW	2	155995394	missense	probably benign	0.00
R7131:Cep250	UTSW	2	155965077	missense	probably damaging	1.00
R7178:Cep250	UTSW	2	155973455	nonsense	probably null
R7241:Cep250	UTSW	2	155991552	missense	probably benign	0.20
R7264:Cep250	UTSW	2	155979151	missense	probably damaging	0.99
R7290:Cep250	UTSW	2	155992762	missense	probably benign	0.03
R7367:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R7397:Cep250	UTSW	2	155981411	missense	probably damaging	0.99
R7768:Cep250	UTSW	2	155986009	missense
R7823:Cep250	UTSW	2	155965416	missense	possibly damaging	0.89
X0061:Cep250	UTSW	2	155961985	missense	probably benign	0.05
Z1177:Cep250	UTSW	2	155976467	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TAGCAGGAGCCTTGTCAAC -3'
(R):5'- CTGTCACAACTACTCTGGCC -3'

Sequencing Primer
(F):5'- GAGCCTTGTCAACCGCTTG -3'
(R):5'- AACTACTCTGGCCCCTGGAG -3'

Posted On

2014-12-29