Incidental Mutation 'R2965:Cntln'
ID 256006
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 040521-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R2965 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 84892264 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably null
Transcript: ENSMUST00000047023
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169371
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,275,829 (GRCm39) R511* probably null Het
Add1 C A 5: 34,788,058 (GRCm39) D702E probably benign Het
Aff3 A G 1: 38,248,791 (GRCm39) I772T probably damaging Het
Ankar T C 1: 72,714,979 (GRCm39) I382V probably benign Het
Anks1 A G 17: 28,272,879 (GRCm39) T925A probably benign Het
Asprv1 T A 6: 86,605,348 (GRCm39) C65S probably damaging Het
Atp8a1 T C 5: 67,805,049 (GRCm39) D1022G probably benign Het
Cep250 A G 2: 155,836,798 (GRCm39) K2256E probably benign Het
Chsy1 G A 7: 65,821,912 (GRCm39) G716R probably damaging Het
Col13a1 G A 10: 61,797,110 (GRCm39) R106W probably damaging Het
Col2a1 A G 15: 97,873,976 (GRCm39) I1402T unknown Het
Col4a3 T C 1: 82,626,321 (GRCm39) L86P unknown Het
Cul9 A G 17: 46,813,154 (GRCm39) V2355A probably damaging Het
Ddx43 C A 9: 78,313,661 (GRCm39) Y197* probably null Het
Dnah7b T A 1: 46,246,732 (GRCm39) I1636N probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Dyrk2 T A 10: 118,696,242 (GRCm39) K339* probably null Het
Fam187b A C 7: 30,677,154 (GRCm39) D221A probably benign Het
Fbxw21 A G 9: 108,974,578 (GRCm39) I314T probably benign Het
Fgd6 T A 10: 93,880,056 (GRCm39) F303L probably benign Het
Fstl3 T C 10: 79,617,057 (GRCm39) V200A probably benign Het
Gm10784 A T 13: 50,099,233 (GRCm39) noncoding transcript Het
Gpr45 G A 1: 43,071,668 (GRCm39) D104N possibly damaging Het
Gria1 C T 11: 57,076,627 (GRCm39) Q8* probably null Het
H2-T22 A G 17: 36,351,537 (GRCm39) L231S probably damaging Het
Ice1 A T 13: 70,750,697 (GRCm39) D1796E probably benign Het
Ing1 T A 8: 11,611,641 (GRCm39) S26R probably benign Het
Klhl2 C T 8: 65,205,794 (GRCm39) V376M probably benign Het
Lrriq1 A G 10: 103,050,761 (GRCm39) S664P probably benign Het
Ltf G T 9: 110,857,540 (GRCm39) C443F possibly damaging Het
Mgam T C 6: 40,745,154 (GRCm39) V1807A possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Mycbp2 A G 14: 103,534,794 (GRCm39) V304A probably benign Het
Nek10 T C 14: 14,836,202 (GRCm38) L141P probably damaging Het
Noa1 T C 5: 77,454,191 (GRCm39) E483G possibly damaging Het
Or5b101 C T 19: 13,005,412 (GRCm39) A94T probably benign Het
Pkd1l1 T A 11: 8,824,236 (GRCm39) S1110C probably damaging Het
Potefam1 A T 2: 111,034,364 (GRCm39) S359T possibly damaging Het
Ppp4r4 T C 12: 103,579,080 (GRCm39) S873P probably damaging Het
Prss35 A G 9: 86,637,635 (GRCm39) D135G probably damaging Het
Pth T C 7: 112,985,136 (GRCm39) H79R probably benign Het
Rab21 T C 10: 115,130,814 (GRCm39) N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Slc4a5 C T 6: 83,273,651 (GRCm39) T997I probably damaging Het
Ssrp1 A G 2: 84,871,930 (GRCm39) T385A possibly damaging Het
Tcf15 T C 2: 151,985,871 (GRCm39) I109T probably damaging Het
Tcp11 C A 17: 28,288,239 (GRCm39) D330Y probably benign Het
Tktl2 T A 8: 66,964,715 (GRCm39) V91E probably benign Het
Usp48 G A 4: 137,341,073 (GRCm39) V358M probably damaging Het
Vmn1r228 A G 17: 20,996,609 (GRCm39) I303T probably damaging Het
Zfp229 T G 17: 21,965,010 (GRCm39) H413Q probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCTGCACAGGAAAGAGC -3'
(R):5'- GTCACACATCAGGATCACACTTG -3'

Sequencing Primer
(F):5'- CTGCACAGGAAAGAGCTGCAG -3'
(R):5'- CTGATTACAAGTTGCTTTTATGTCTG -3'
Posted On 2014-12-29