Incidental Mutation 'R2965:Dpysl5'
ID 256008
Institutional Source Beutler Lab
Gene Symbol Dpysl5
Ensembl Gene ENSMUSG00000029168
Gene Name dihydropyrimidinase-like 5
Synonyms CRMP-5, Crmp5, CRAM
MMRRC Submission 040521-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.234) question?
Stock # R2965 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 30868908-30956713 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30948941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 399 (D399N)
Ref Sequence ENSEMBL: ENSMUSP00000110377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088081] [ENSMUST00000114729]
AlphaFold Q9EQF6
Predicted Effect probably damaging
Transcript: ENSMUST00000088081
AA Change: D399N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168
AA Change: D399N

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114729
AA Change: D399N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168
AA Change: D399N

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198503
Meta Mutation Damage Score 0.9385 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, abnormal Purkinje morphology, absent long term depression, and no response to BDNF. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,275,829 (GRCm39) R511* probably null Het
Add1 C A 5: 34,788,058 (GRCm39) D702E probably benign Het
Aff3 A G 1: 38,248,791 (GRCm39) I772T probably damaging Het
Ankar T C 1: 72,714,979 (GRCm39) I382V probably benign Het
Anks1 A G 17: 28,272,879 (GRCm39) T925A probably benign Het
Asprv1 T A 6: 86,605,348 (GRCm39) C65S probably damaging Het
Atp8a1 T C 5: 67,805,049 (GRCm39) D1022G probably benign Het
Cep250 A G 2: 155,836,798 (GRCm39) K2256E probably benign Het
Chsy1 G A 7: 65,821,912 (GRCm39) G716R probably damaging Het
Cntln T C 4: 84,892,264 (GRCm39) probably null Het
Col13a1 G A 10: 61,797,110 (GRCm39) R106W probably damaging Het
Col2a1 A G 15: 97,873,976 (GRCm39) I1402T unknown Het
Col4a3 T C 1: 82,626,321 (GRCm39) L86P unknown Het
Cul9 A G 17: 46,813,154 (GRCm39) V2355A probably damaging Het
Ddx43 C A 9: 78,313,661 (GRCm39) Y197* probably null Het
Dnah7b T A 1: 46,246,732 (GRCm39) I1636N probably damaging Het
Dyrk2 T A 10: 118,696,242 (GRCm39) K339* probably null Het
Fam187b A C 7: 30,677,154 (GRCm39) D221A probably benign Het
Fbxw21 A G 9: 108,974,578 (GRCm39) I314T probably benign Het
Fgd6 T A 10: 93,880,056 (GRCm39) F303L probably benign Het
Fstl3 T C 10: 79,617,057 (GRCm39) V200A probably benign Het
Gm10784 A T 13: 50,099,233 (GRCm39) noncoding transcript Het
Gpr45 G A 1: 43,071,668 (GRCm39) D104N possibly damaging Het
Gria1 C T 11: 57,076,627 (GRCm39) Q8* probably null Het
H2-T22 A G 17: 36,351,537 (GRCm39) L231S probably damaging Het
Ice1 A T 13: 70,750,697 (GRCm39) D1796E probably benign Het
Ing1 T A 8: 11,611,641 (GRCm39) S26R probably benign Het
Klhl2 C T 8: 65,205,794 (GRCm39) V376M probably benign Het
Lrriq1 A G 10: 103,050,761 (GRCm39) S664P probably benign Het
Ltf G T 9: 110,857,540 (GRCm39) C443F possibly damaging Het
Mgam T C 6: 40,745,154 (GRCm39) V1807A possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Mycbp2 A G 14: 103,534,794 (GRCm39) V304A probably benign Het
Nek10 T C 14: 14,836,202 (GRCm38) L141P probably damaging Het
Noa1 T C 5: 77,454,191 (GRCm39) E483G possibly damaging Het
Or5b101 C T 19: 13,005,412 (GRCm39) A94T probably benign Het
Pkd1l1 T A 11: 8,824,236 (GRCm39) S1110C probably damaging Het
Potefam1 A T 2: 111,034,364 (GRCm39) S359T possibly damaging Het
Ppp4r4 T C 12: 103,579,080 (GRCm39) S873P probably damaging Het
Prss35 A G 9: 86,637,635 (GRCm39) D135G probably damaging Het
Pth T C 7: 112,985,136 (GRCm39) H79R probably benign Het
Rab21 T C 10: 115,130,814 (GRCm39) N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Slc4a5 C T 6: 83,273,651 (GRCm39) T997I probably damaging Het
Ssrp1 A G 2: 84,871,930 (GRCm39) T385A possibly damaging Het
Tcf15 T C 2: 151,985,871 (GRCm39) I109T probably damaging Het
Tcp11 C A 17: 28,288,239 (GRCm39) D330Y probably benign Het
Tktl2 T A 8: 66,964,715 (GRCm39) V91E probably benign Het
Usp48 G A 4: 137,341,073 (GRCm39) V358M probably damaging Het
Vmn1r228 A G 17: 20,996,609 (GRCm39) I303T probably damaging Het
Zfp229 T G 17: 21,965,010 (GRCm39) H413Q probably damaging Het
Other mutations in Dpysl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Dpysl5 APN 5 30,902,622 (GRCm39) missense probably damaging 1.00
IGL02277:Dpysl5 APN 5 30,946,125 (GRCm39) missense probably damaging 1.00
R0517:Dpysl5 UTSW 5 30,935,410 (GRCm39) missense probably damaging 0.99
R0788:Dpysl5 UTSW 5 30,946,185 (GRCm39) critical splice donor site probably null
R1716:Dpysl5 UTSW 5 30,935,338 (GRCm39) missense probably benign 0.00
R2016:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2208:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2211:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R4440:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 0.99
R4863:Dpysl5 UTSW 5 30,941,687 (GRCm39) missense probably benign 0.08
R4918:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 1.00
R5377:Dpysl5 UTSW 5 30,948,857 (GRCm39) missense probably damaging 1.00
R6379:Dpysl5 UTSW 5 30,935,317 (GRCm39) critical splice acceptor site probably null
R6621:Dpysl5 UTSW 5 30,941,813 (GRCm39) critical splice donor site probably null
R7199:Dpysl5 UTSW 5 30,940,539 (GRCm39) missense probably benign 0.21
R7232:Dpysl5 UTSW 5 30,949,642 (GRCm39) missense probably benign 0.03
R7388:Dpysl5 UTSW 5 30,902,805 (GRCm39) missense probably benign
R7446:Dpysl5 UTSW 5 30,936,231 (GRCm39) missense probably benign 0.00
R7868:Dpysl5 UTSW 5 30,902,760 (GRCm39) missense probably damaging 1.00
R8041:Dpysl5 UTSW 5 30,953,658 (GRCm39) missense probably benign 0.28
R8428:Dpysl5 UTSW 5 30,902,811 (GRCm39) missense probably damaging 0.99
R8835:Dpysl5 UTSW 5 30,936,282 (GRCm39) critical splice donor site probably null
R8888:Dpysl5 UTSW 5 30,902,687 (GRCm39) missense probably benign 0.01
R8943:Dpysl5 UTSW 5 30,935,375 (GRCm39) missense probably benign 0.33
R9033:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R9139:Dpysl5 UTSW 5 30,935,397 (GRCm39) missense probably benign 0.45
R9305:Dpysl5 UTSW 5 30,948,959 (GRCm39) missense probably damaging 1.00
R9522:Dpysl5 UTSW 5 30,935,399 (GRCm39) nonsense probably null
R9700:Dpysl5 UTSW 5 30,904,417 (GRCm39) nonsense probably null
Z1176:Dpysl5 UTSW 5 30,935,464 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGATAAATGACCACAGCTGG -3'
(R):5'- AGGAATGGTACCCAGAACTGTC -3'

Sequencing Primer
(F):5'- CTGGGGTAGCAAGTGCCTG -3'
(R):5'- GGAACATGGTCATCTGCATACCG -3'
Posted On 2014-12-29