Mutagenetix > Incidental Mutation

Incidental Mutation 'R0322:Bub1b'

25601

Institutional Source

Beutler Lab

Gene Symbol

Bub1b

Ensembl Gene

ENSMUSG00000040084

Gene Name

BUB1B, mitotic checkpoint serine/threonine kinase

Synonyms

BUBR1

MMRRC Submission

038532-MU

Accession Numbers

NM_009773; MGI: 1333889

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0322 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118598211-118641591 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 118639618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000037126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038341]

AlphaFold

Q9Z1S0

Predicted Effect

probably benign
Transcript: ENSMUST00000038341

SMART Domains

Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084

Domain	Start	End	E-Value	Type
PDB:4GGD\|D	14	35	6e-6	PDB
Mad3_BUB1_I	49	173	1.83e-68	SMART
low complexity region	198	214	N/A	INTRINSIC
low complexity region	382	395	N/A	INTRINSIC
coiled coil region	418	457	N/A	INTRINSIC
low complexity region	671	686	N/A	INTRINSIC
low complexity region	717	726	N/A	INTRINSIC
Pfam:Pkinase	806	942	4.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126013

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.8%
20x: 84.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant embryos undergo extensive apoptosis and die during early gestation. Heterozygous mice are viable and exhibit splenomegaly, abnormal megakaryopoiesis, and an increased susceptibility to intestinal tumorigenesis. Hypomorphic homozygotes display infertility and premature aging. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(18)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,025,372	S275T	possibly damaging	Het
Adam34	G	T	8: 43,651,921	T229N	probably benign	Het
Adgrb3	C	A	1: 25,221,748		probably benign	Het
Ankhd1	T	A	18: 36,658,008	Y2478*	probably null	Het
Arl9	A	G	5: 77,007,190		probably benign	Het
Chl1	A	T	6: 103,701,883		probably benign	Het
Cobl	T	A	11: 12,267,072	E465V	probably damaging	Het
Cobll1	A	T	2: 65,102,098	M520K	possibly damaging	Het
Dll3	A	G	7: 28,296,368	V336A	possibly damaging	Het
Dnmbp	T	C	19: 43,854,846	H1193R	probably damaging	Het
Fbxo43	T	C	15: 36,152,192		probably benign	Het
Gart	G	A	16: 91,623,037		probably benign	Het
Gjc3	A	T	5: 137,957,498	M175K	possibly damaging	Het
Gm9008	T	C	6: 76,496,418	Y405C	probably benign	Het
Gpc5	T	A	14: 115,399,151	N415K	probably benign	Het
Idh2	C	T	7: 80,098,257	A232T	probably damaging	Het
Il7r	A	T	15: 9,510,215	F251I	probably benign	Het
Insc	A	G	7: 114,792,265	E141G	probably damaging	Het
Itm2c	C	T	1: 85,907,030	T160M	probably damaging	Het
Mboat1	T	C	13: 30,232,080		probably benign	Het
Mdm2	G	T	10: 117,702,204	H96Q	possibly damaging	Het
Mettl13	A	G	1: 162,544,176		probably benign	Het
Mfsd4b3	T	C	10: 39,947,530	N245D	probably damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mtmr3	T	C	11: 4,487,505	Y982C	possibly damaging	Het
Mymk	A	T	2: 27,067,406	L66Q	probably damaging	Het
Myo18a	T	C	11: 77,829,800	S767P	probably damaging	Het
Ndufa8	T	C	2: 36,036,622	D134G	probably benign	Het
Noxa1	A	G	2: 25,092,554	F83S	probably damaging	Het
Npc1l1	T	A	11: 6,229,042	I123L	probably benign	Het
Ogdhl	A	G	14: 32,337,577	T394A	probably benign	Het
Olfr1193	T	C	2: 88,678,667	S264P	probably damaging	Het
Olfr290	A	G	7: 84,916,313	Y178C	probably damaging	Het
Pcdh20	T	C	14: 88,468,947	T306A	probably benign	Het
Pcid2	G	A	8: 13,090,775		probably benign	Het
Phyhip	G	A	14: 70,463,396	V108M	possibly damaging	Het
Pnpla5	G	T	15: 84,120,719	L144M	probably damaging	Het
Psmb4	A	G	3: 94,886,091	Y160H	probably benign	Het
Riox2	A	T	16: 59,489,389	K369*	probably null	Het
Sh3tc1	G	A	5: 35,706,561	P761S	possibly damaging	Het
Slc6a3	T	A	13: 73,560,926	V323D	possibly damaging	Het
Smg7	A	G	1: 152,849,873		probably null	Het
Srrt	G	A	5: 137,296,608	R370C	probably damaging	Het
Stc1	T	C	14: 69,029,409	V7A	probably benign	Het
Svep1	G	T	4: 58,057,996		probably benign	Het
Tbpl2	A	G	2: 24,094,979	V51A	probably benign	Het
Tecr	A	G	8: 83,572,243	Y248H	probably damaging	Het
Tenm3	A	G	8: 48,236,912		probably benign	Het
Tia1	C	T	6: 86,420,387	A114V	probably damaging	Het
Tmprss11f	A	T	5: 86,591,416	M2K	probably benign	Het
Tnfsf8	T	C	4: 63,834,166	T221A	probably damaging	Het
Tubgcp5	G	A	7: 55,814,978	G536S	probably damaging	Het
Tyr	A	T	7: 87,492,917	I145N	probably benign	Het
Ubr4	T	A	4: 139,422,418	V1809E	probably damaging	Het
Vmn2r65	A	T	7: 84,946,548	N309K	probably benign	Het

Other mutations in Bub1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Bub1b	APN	2	118630138	missense	probably benign
IGL01319:Bub1b	APN	2	118614994	missense	possibly damaging	0.49
IGL01744:Bub1b	APN	2	118636749	missense	probably damaging	0.99
IGL03184:Bub1b	APN	2	118609777	splice site	probably benign
P0035:Bub1b	UTSW	2	118622185	missense	probably damaging	1.00
R0315:Bub1b	UTSW	2	118626976	splice site	probably benign
R0378:Bub1b	UTSW	2	118641123	missense	probably benign	0.01
R0457:Bub1b	UTSW	2	118609859	missense	probably damaging	1.00
R0845:Bub1b	UTSW	2	118609976	missense	probably damaging	1.00
R0960:Bub1b	UTSW	2	118606680	missense	probably benign	0.03
R1071:Bub1b	UTSW	2	118632447	frame shift	probably null
R1129:Bub1b	UTSW	2	118615006	missense	probably damaging	1.00
R1138:Bub1b	UTSW	2	118623089	missense	probably benign	0.01
R1171:Bub1b	UTSW	2	118606686	missense	probably benign	0.31
R1613:Bub1b	UTSW	2	118639741	critical splice donor site	probably null
R1667:Bub1b	UTSW	2	118641189	missense	probably benign	0.00
R1812:Bub1b	UTSW	2	118632421	missense	probably benign	0.00
R1828:Bub1b	UTSW	2	118638439	missense	probably benign	0.00
R2085:Bub1b	UTSW	2	118622195	missense	possibly damaging	0.88
R2137:Bub1b	UTSW	2	118636718	nonsense	probably null
R3749:Bub1b	UTSW	2	118615455	missense	possibly damaging	0.63
R3750:Bub1b	UTSW	2	118615455	missense	possibly damaging	0.63
R4211:Bub1b	UTSW	2	118630978	missense	possibly damaging	0.78
R4579:Bub1b	UTSW	2	118623176	nonsense	probably null
R4993:Bub1b	UTSW	2	118636770	missense	possibly damaging	0.63
R5144:Bub1b	UTSW	2	118615499	missense	possibly damaging	0.92
R5229:Bub1b	UTSW	2	118629989	missense	probably damaging	1.00
R5596:Bub1b	UTSW	2	118630982	missense	probably damaging	1.00
R5656:Bub1b	UTSW	2	118605431	missense	probably damaging	1.00
R5785:Bub1b	UTSW	2	118609844	missense	probably damaging	0.98
R5883:Bub1b	UTSW	2	118609882	missense	probably damaging	1.00
R6128:Bub1b	UTSW	2	118617812	missense	probably benign
R6187:Bub1b	UTSW	2	118631000	missense	probably damaging	1.00
R6333:Bub1b	UTSW	2	118598463	critical splice donor site	probably null
R6985:Bub1b	UTSW	2	118606614	missense	probably damaging	1.00
R6988:Bub1b	UTSW	2	118636830	missense	probably damaging	0.96
R7161:Bub1b	UTSW	2	118626053	missense	probably damaging	1.00
R7341:Bub1b	UTSW	2	118636786	missense	possibly damaging	0.95
R7575:Bub1b	UTSW	2	118641158	missense	possibly damaging	0.51
R7824:Bub1b	UTSW	2	118626967	splice site	probably null
R8129:Bub1b	UTSW	2	118638494	missense	probably benign	0.06
R8702:Bub1b	UTSW	2	118638494	missense	probably benign	0.06
R8787:Bub1b	UTSW	2	118631824	missense	probably damaging	1.00
R9569:Bub1b	UTSW	2	118638403	missense	not run

Predicted Primers

PCR Primer
(F):5'- AAGCGGTTATGTGGGCCACAGTAG -3'
(R):5'- TGAACGCAGAGACAGCACTTGG -3'

Sequencing Primer
(F):5'- acgcctttaatcccagcac -3'
(R):5'- GTTGCCTACCACAGCAGAG -3'

Posted On

2013-04-16