Incidental Mutation 'R2965:Fam187b'
ID256015
Institutional Source Beutler Lab
Gene Symbol Fam187b
Ensembl Gene ENSMUSG00000046826
Gene Namefamily with sequence similarity 187, member B
Synonyms1700020B09Rik, Tmem162
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30973790-30989726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30977729 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 221 (D221A)
Ref Sequence ENSEMBL: ENSMUSP00000057020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001279] [ENSMUST00000058093] [ENSMUST00000098553] [ENSMUST00000108116] [ENSMUST00000128384] [ENSMUST00000129773] [ENSMUST00000147431] [ENSMUST00000205961]
Predicted Effect probably benign
Transcript: ENSMUST00000001279
SMART Domains Protein: ENSMUSP00000001279
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 206 253 9.6e-27 PFAM
low complexity region 280 296 N/A INTRINSIC
low complexity region 445 464 N/A INTRINSIC
low complexity region 468 487 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058093
AA Change: D221A

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057020
Gene: ENSMUSG00000046826
AA Change: D221A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:IG 27 116 4e-30 BLAST
Blast:IG_like 223 290 4e-6 BLAST
transmembrane domain 324 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098553
SMART Domains Protein: ENSMUSP00000096153
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
low complexity region 212 228 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 400 419 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108116
SMART Domains Protein: ENSMUSP00000103751
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 187 235 2.3e-25 PFAM
low complexity region 261 277 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 477 494 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128384
SMART Domains Protein: ENSMUSP00000144424
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Blast:IG 45 133 2e-17 BLAST
SCOP:d1wiu__ 53 125 1e-3 SMART
IG_like 238 306 1.9e-2 SMART
transmembrane domain 340 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129773
SMART Domains Protein: ENSMUSP00000144533
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
transmembrane domain 61 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147431
SMART Domains Protein: ENSMUSP00000123487
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 253 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206754
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Ankar T C 1: 72,675,820 I382V probably benign Het
Anks1 A G 17: 28,053,905 T925A probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Ssrp1 A G 2: 85,041,586 T385A possibly damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in Fam187b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0131:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0131:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0132:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0594:Fam187b UTSW 7 30977154 nonsense probably null
R1728:Fam187b UTSW 7 30989020 nonsense probably null
R3104:Fam187b UTSW 7 30977240 missense probably benign 0.00
R3106:Fam187b UTSW 7 30977240 missense probably benign 0.00
R4607:Fam187b UTSW 7 30977745 missense probably benign 0.28
R4608:Fam187b UTSW 7 30977745 missense probably benign 0.28
R4612:Fam187b UTSW 7 30977093 missense possibly damaging 0.69
R4672:Fam187b UTSW 7 30977543 missense probably damaging 1.00
R4801:Fam187b UTSW 7 30977090 missense possibly damaging 0.84
R4802:Fam187b UTSW 7 30977090 missense possibly damaging 0.84
R4959:Fam187b UTSW 7 30982262 missense probably damaging 1.00
R5820:Fam187b UTSW 7 30977152 missense probably damaging 1.00
R6351:Fam187b UTSW 7 30977599 missense probably damaging 1.00
R6624:Fam187b UTSW 7 30977187 missense probably benign 0.26
R6823:Fam187b UTSW 7 30989290 missense probably benign 0.01
X0063:Fam187b UTSW 7 30989320 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGTGAGCGCAAACGTCTAG -3'
(R):5'- CCTCTAGACTCTGACCATGAAGG -3'

Sequencing Primer
(F):5'- GCAAACGTCTAGGCTACTGCTATG -3'
(R):5'- AGACTCTGACCATGAAGGCTTCTG -3'
Posted On2014-12-29