Mutagenetix > Incidental Mutations

Incidental Mutation 'R2965:Chsy1'

256017

Institutional Source

Beutler Lab

Gene Symbol

Chsy1

Ensembl Gene

ENSMUSG00000032640

Gene Name

chondroitin sulfate synthase 1

Synonyms

MMRRC Submission

040521-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66109515-66173798 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 66172164 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 716 (G716R)

Ref Sequence

ENSEMBL: ENSMUSP00000047487 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036372]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036372
AA Change: G716R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047487
Gene: ENSMUSG00000032640
AA Change: G716R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Fringe	81	307	3.8e-21	PFAM
Pfam:CHGN	237	776	9.8e-197	PFAM
Pfam:Glyco_tranf_2_2	548	751	1.2e-10	PFAM
Pfam:Glyco_transf_7C	674	747	2.5e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181911

Meta Mutation Damage Score

0.7900

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. These enzymes possess dual glucuronyltransferase and galactosaminyltransferase activity and play critical roles in the biosynthesis of chondroitin sulfate, a glycosaminoglycan involved in many biological processes including cell proliferation and morphogenesis. Decreased expression of this gene may play a role in colorectal cancer, and mutations in this gene are a cause of temtamy preaxial brachydactyly syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mice are viable, but display chondrodysplasia, brachydactyly and decreased bone density. Retinal degeneration, impaired motor strength, and hematological abnormalities are also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	C	T	7: 41,626,405	R511*	probably null	Het
4930430A15Rik	A	T	2: 111,204,019	S359T	possibly damaging	Het
Add1	C	A	5: 34,630,714	D702E	probably benign	Het
Aff3	A	G	1: 38,209,710	I772T	probably damaging	Het
Ankar	T	C	1: 72,675,820	I382V	probably benign	Het
Anks1	A	G	17: 28,053,905	T925A	probably benign	Het
Asprv1	T	A	6: 86,628,366	C65S	probably damaging	Het
Atp8a1	T	C	5: 67,647,706	D1022G	probably benign	Het
Cep250	A	G	2: 155,994,878	K2256E	probably benign	Het
Cntln	T	C	4: 84,974,027		probably null	Het
Col13a1	G	A	10: 61,961,331	R106W	probably damaging	Het
Col2a1	A	G	15: 97,976,095	I1402T	unknown	Het
Col4a3	T	C	1: 82,648,600	L86P	unknown	Het
Cul9	A	G	17: 46,502,228	V2355A	probably damaging	Het
Ddx43	C	A	9: 78,406,379	Y197*	probably null	Het
Dnah7b	T	A	1: 46,207,572	I1636N	probably damaging	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Dyrk2	T	A	10: 118,860,337	K339*	probably null	Het
Fam187b	A	C	7: 30,977,729	D221A	probably benign	Het
Fbxw21	A	G	9: 109,145,510	I314T	probably benign	Het
Fgd6	T	A	10: 94,044,194	F303L	probably benign	Het
Fstl3	T	C	10: 79,781,223	V200A	probably benign	Het
Gm10784	A	T	13: 49,945,197		noncoding transcript	Het
Gpr45	G	A	1: 43,032,508	D104N	possibly damaging	Het
Gria1	C	T	11: 57,185,801	Q8*	probably null	Het
H2-T22	A	G	17: 36,040,645	L231S	probably damaging	Het
Ice1	A	T	13: 70,602,578	D1796E	probably benign	Het
Ing1	T	A	8: 11,561,641	S26R	probably benign	Het
Klhl2	C	T	8: 64,752,760	V376M	probably benign	Het
Lrriq1	A	G	10: 103,214,900	S664P	probably benign	Het
Ltf	G	T	9: 111,028,472	C443F	possibly damaging	Het
Mgam	T	C	6: 40,768,220	V1807A	possibly damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Mycbp2	A	G	14: 103,297,358	V304A	probably benign	Het
Nek10	T	C	14: 14,836,202	L141P	probably damaging	Het
Noa1	T	C	5: 77,306,344	E483G	possibly damaging	Het
Olfr1453	C	T	19: 13,028,048	A94T	probably benign	Het
Pkd1l1	T	A	11: 8,874,236	S1110C	probably damaging	Het
Ppp4r4	T	C	12: 103,612,821	S873P	probably damaging	Het
Prss35	A	G	9: 86,755,582	D135G	probably damaging	Het
Pth	T	C	7: 113,385,929	H79R	probably benign	Het
Rab21	T	C	10: 115,294,909	N164S	probably benign	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Het
Slc4a5	C	T	6: 83,296,669	T997I	probably damaging	Het
Ssrp1	A	G	2: 85,041,586	T385A	possibly damaging	Het
Tcf15	T	C	2: 152,143,951	I109T	probably damaging	Het
Tcp11	C	A	17: 28,069,265	D330Y	probably benign	Het
Tktl2	T	A	8: 66,512,063	V91E	probably benign	Het
Usp48	G	A	4: 137,613,762	V358M	probably damaging	Het
Vmn1r228	A	G	17: 20,776,347	I303T	probably damaging	Het
Zfp229	T	G	17: 21,746,029	H413Q	probably damaging	Het

Other mutations in Chsy1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01087:Chsy1	APN	7	66172126	missense	possibly damaging	0.70
IGL01734:Chsy1	APN	7	66171310	missense	probably damaging	0.98
IGL02037:Chsy1	APN	7	66171828	missense	possibly damaging	0.69
IGL02797:Chsy1	APN	7	66171664	missense	probably damaging	1.00
IGL02961:Chsy1	APN	7	66171782	missense	probably benign	0.00
IGL03290:Chsy1	APN	7	66171031	missense	probably benign	0.15
IGL03292:Chsy1	APN	7	66125372	missense	probably benign	0.02
Chrysanthemum	UTSW	7	66110229	critical splice donor site	probably null
coesite	UTSW	7	66125463	missense	probably damaging	1.00
deprimido	UTSW	7	66171687	missense	probably damaging	1.00
Elevado	UTSW	7	66110076	nonsense	probably null
R0669:Chsy1	UTSW	7	66171687	missense	probably damaging	1.00
R1336:Chsy1	UTSW	7	66125239	splice site	probably null
R1499:Chsy1	UTSW	7	66172002	missense	probably damaging	1.00
R1640:Chsy1	UTSW	7	66171514	missense	probably benign	0.34
R1674:Chsy1	UTSW	7	66171663	missense	probably damaging	1.00
R1812:Chsy1	UTSW	7	66171817	missense	probably benign	0.12
R1934:Chsy1	UTSW	7	66172243	missense	probably damaging	1.00
R2964:Chsy1	UTSW	7	66172164	missense	probably damaging	1.00
R2966:Chsy1	UTSW	7	66172164	missense	probably damaging	1.00
R3692:Chsy1	UTSW	7	66171253	missense	probably damaging	1.00
R4890:Chsy1	UTSW	7	66110226	missense	probably benign	0.00
R5373:Chsy1	UTSW	7	66110076	nonsense	probably null
R5936:Chsy1	UTSW	7	66172277	missense	possibly damaging	0.89
R6149:Chsy1	UTSW	7	66125385	missense	probably damaging	1.00
R6192:Chsy1	UTSW	7	66170877	missense	probably benign	0.29
R6653:Chsy1	UTSW	7	66110193	missense	probably benign	0.10
R6848:Chsy1	UTSW	7	66171037	missense	probably damaging	1.00
R7318:Chsy1	UTSW	7	66110229	critical splice donor site	probably null
R7514:Chsy1	UTSW	7	66172120	missense	probably damaging	1.00
R7560:Chsy1	UTSW	7	66171244	missense	possibly damaging	0.85
R7560:Chsy1	UTSW	7	66171571	missense	probably damaging	1.00
R7655:Chsy1	UTSW	7	66171030	missense	probably damaging	0.98
R7656:Chsy1	UTSW	7	66171030	missense	probably damaging	0.98
R8410:Chsy1	UTSW	7	66125463	missense	probably damaging	1.00
R8478:Chsy1	UTSW	7	66171000	missense	probably benign
X0012:Chsy1	UTSW	7	66172168	missense	probably damaging	1.00
X0063:Chsy1	UTSW	7	66171924	missense	probably benign	0.05
Z1176:Chsy1	UTSW	7	66172226	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCAGCAGATCTATTTCCC -3'
(R):5'- TTTCTAGCCACATTTCGGCCAG -3'

Sequencing Primer
(F):5'- GGCAGCAGATCTATTTCCCAATCATC -3'
(R):5'- ATTTCGGCCAGCTGCTGC -3'

Posted On

2014-12-29