Incidental Mutation 'R2965:Ing1'
ID256020
Institutional Source Beutler Lab
Gene Symbol Ing1
Ensembl Gene ENSMUSG00000045969
Gene Nameinhibitor of growth family, member 1
Synonyms2610028J21Rik, p33Ing1, mING1h
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location11555571-11563251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11561641 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 26 (S26R)
Ref Sequence ENSEMBL: ENSMUSP00000148248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054399] [ENSMUST00000209565] [ENSMUST00000209646] [ENSMUST00000210041] [ENSMUST00000210670] [ENSMUST00000210740] [ENSMUST00000211007]
Predicted Effect probably benign
Transcript: ENSMUST00000054399
AA Change: S120R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062593
Gene: ENSMUSG00000045969
AA Change: S120R

DomainStartEndE-ValueType
Pfam:ING 15 113 1.4e-33 PFAM
low complexity region 146 165 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
PHD 212 257 2.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209565
AA Change: S26R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000209646
AA Change: S26R

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000210041
AA Change: S26R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000210670
Predicted Effect probably benign
Transcript: ENSMUST00000210740
AA Change: S26R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000211007
AA Change: S26R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display a slight decrease in body weight, moderately impaired maternal nurturing, increased sensitivity to gamma-irradiation, and increased incidence of B-cell derived lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Ankar T C 1: 72,675,820 I382V probably benign Het
Anks1 A G 17: 28,053,905 T925A probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fam187b A C 7: 30,977,729 D221A probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Ssrp1 A G 2: 85,041,586 T385A possibly damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in Ing1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ing1 APN 8 11561453 missense probably benign 0.33
F5770:Ing1 UTSW 8 11561934 missense probably damaging 1.00
R0422:Ing1 UTSW 8 11561933 missense probably damaging 0.98
R0546:Ing1 UTSW 8 11557031 missense probably damaging 1.00
R1295:Ing1 UTSW 8 11561501 missense probably benign 0.00
R1295:Ing1 UTSW 8 11561502 missense probably damaging 0.96
R1433:Ing1 UTSW 8 11557010 missense probably damaging 0.98
R1914:Ing1 UTSW 8 11561577 missense probably damaging 1.00
R2964:Ing1 UTSW 8 11561641 missense probably benign 0.09
R4559:Ing1 UTSW 8 11562090 missense probably benign 0.01
R6884:Ing1 UTSW 8 11561916 missense probably damaging 1.00
R7775:Ing1 UTSW 8 11561814 missense probably benign 0.00
R7778:Ing1 UTSW 8 11561814 missense probably benign 0.00
R7824:Ing1 UTSW 8 11561814 missense probably benign 0.00
V7583:Ing1 UTSW 8 11561934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGAGCTGGACGACTAC -3'
(R):5'- GTTGCACAGACAGTACGTGG -3'

Sequencing Primer
(F):5'- CTGGACGACTACTATGAGAAGTTC -3'
(R):5'- AGGAGACGCTTCCCTCTCTG -3'
Posted On2014-12-29