Incidental Mutation 'R2965:Col13a1'
ID256027
Institutional Source Beutler Lab
Gene Symbol Col13a1
Ensembl Gene ENSMUSG00000058806
Gene Namecollagen, type XIII, alpha 1
Synonyms
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location61838236-61979108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61961331 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 106 (R106W)
Ref Sequence ENSEMBL: ENSMUSP00000101094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105452] [ENSMUST00000105453] [ENSMUST00000105454]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051826
Predicted Effect probably damaging
Transcript: ENSMUST00000105452
AA Change: R106W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101092
Gene: ENSMUSG00000058806
AA Change: R106W

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
Pfam:Collagen 154 214 1.6e-12 PFAM
Pfam:Collagen 255 319 1.8e-10 PFAM
Pfam:Collagen 283 338 7.8e-11 PFAM
Pfam:Collagen 313 376 6.8e-10 PFAM
Pfam:Collagen 377 436 3e-10 PFAM
Pfam:Collagen 458 517 4.3e-12 PFAM
Pfam:Collagen 498 559 7.7e-12 PFAM
Pfam:Collagen 557 616 1.6e-11 PFAM
Pfam:Collagen 587 666 9.8e-8 PFAM
Pfam:Collagen 635 704 4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105453
AA Change: R106W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101093
Gene: ENSMUSG00000058806
AA Change: R106W

DomainStartEndE-ValueType
internal_repeat_5 17 30 7.25e-5 PROSPERO
low complexity region 41 59 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
internal_repeat_5 140 153 7.25e-5 PROSPERO
Pfam:Collagen 154 214 1.5e-12 PFAM
Pfam:Collagen 235 296 1e-10 PFAM
internal_repeat_2 297 328 1.33e-8 PROSPERO
internal_repeat_1 297 332 1.43e-12 PROSPERO
Pfam:Collagen 355 414 2.8e-10 PFAM
Pfam:Collagen 436 495 4.6e-12 PFAM
Pfam:Collagen 477 551 3.6e-8 PFAM
Pfam:Collagen 536 606 5.1e-10 PFAM
Pfam:Collagen 574 670 1.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105454
AA Change: R106W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101094
Gene: ENSMUSG00000058806
AA Change: R106W

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
Pfam:Collagen 112 161 6.7e-9 PFAM
Pfam:Collagen 164 223 1.5e-11 PFAM
Pfam:Collagen 264 328 6.7e-10 PFAM
Pfam:Collagen 292 347 2.8e-10 PFAM
Pfam:Collagen 322 385 2.3e-9 PFAM
Pfam:Collagen 386 445 1.1e-9 PFAM
Pfam:Collagen 467 526 1.6e-11 PFAM
Pfam:Collagen 507 582 4.8e-9 PFAM
Pfam:Collagen 564 630 5.4e-9 PFAM
low complexity region 671 695 N/A INTRINSIC
internal_repeat_2 698 723 7.38e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218711
Meta Mutation Damage Score 0.1694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of one of the nonfibrillar collagens. The function of this gene product is not known, however, it has been detected at low levels in all connective tissue-producing cells so it may serve a general function in connective tissues. Unlike most of the collagens, which are secreted into the extracellular matrix, collagen XIII contains a transmembrane domain and the protein has been localized to the plasma membrane. The transcripts for this gene undergo complex and extensive splicing involving at least eight exons. Like other collagens, collagen XIII is a trimer; it is not known whether this trimer is composed of one or more than one alpha chain isomer. A number of alternatively spliced transcript variants have been described, but the full length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the transmembrane exhibit small muscle fibers and are susceptible to excerise-induced muscle damage and muscle inflammation. Mice homozygous for a knock-out allele exhibit tremors and abnormal neuromuscular junction morphology and endplate potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Ankar T C 1: 72,675,820 I382V probably benign Het
Anks1 A G 17: 28,053,905 T925A probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fam187b A C 7: 30,977,729 D221A probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Ssrp1 A G 2: 85,041,586 T385A possibly damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in Col13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Col13a1 APN 10 61864005 critical splice acceptor site probably null
IGL00936:Col13a1 APN 10 61876290 missense probably damaging 0.99
IGL00963:Col13a1 APN 10 61838697 utr 3 prime probably benign
IGL01801:Col13a1 APN 10 61843614 missense probably damaging 1.00
IGL02247:Col13a1 APN 10 61961345 missense probably damaging 1.00
IGL02296:Col13a1 APN 10 61862025 intron probably benign
IGL02430:Col13a1 APN 10 61874751 missense probably benign 0.26
IGL02884:Col13a1 APN 10 61905285 splice site probably benign
IGL03036:Col13a1 APN 10 61893913 critical splice donor site probably null
IGL03145:Col13a1 APN 10 61891261 missense probably benign 0.07
IGL03392:Col13a1 APN 10 61885711 missense possibly damaging 0.88
R0027:Col13a1 UTSW 10 61850161 missense unknown
R0440:Col13a1 UTSW 10 61867483 missense possibly damaging 0.85
R0518:Col13a1 UTSW 10 61862746 missense unknown
R0521:Col13a1 UTSW 10 61862746 missense unknown
R0631:Col13a1 UTSW 10 61887350 nonsense probably null
R1311:Col13a1 UTSW 10 61864010 splice site probably benign
R1350:Col13a1 UTSW 10 61894069 splice site probably benign
R1572:Col13a1 UTSW 10 61866426 unclassified probably null
R2401:Col13a1 UTSW 10 61851162 missense unknown
R2883:Col13a1 UTSW 10 61978356 missense probably benign 0.23
R2906:Col13a1 UTSW 10 61860488 intron probably benign
R2964:Col13a1 UTSW 10 61961331 missense probably damaging 1.00
R3703:Col13a1 UTSW 10 61867829 critical splice donor site probably null
R3704:Col13a1 UTSW 10 61867829 critical splice donor site probably null
R3844:Col13a1 UTSW 10 61850209 missense unknown
R3928:Col13a1 UTSW 10 61867525 unclassified probably benign
R3939:Col13a1 UTSW 10 61863082 missense unknown
R4327:Col13a1 UTSW 10 61863979 missense unknown
R4328:Col13a1 UTSW 10 61863979 missense unknown
R4329:Col13a1 UTSW 10 61863979 missense unknown
R4585:Col13a1 UTSW 10 61887245 splice site probably null
R4705:Col13a1 UTSW 10 61850165 missense unknown
R4864:Col13a1 UTSW 10 61862660 missense unknown
R5072:Col13a1 UTSW 10 61874018 splice site silent
R5074:Col13a1 UTSW 10 61874018 splice site silent
R5114:Col13a1 UTSW 10 61890101 missense possibly damaging 0.82
R5625:Col13a1 UTSW 10 61843609 missense unknown
R5664:Col13a1 UTSW 10 61851116 missense probably damaging 1.00
R5799:Col13a1 UTSW 10 61849140 intron probably benign
Z1177:Col13a1 UTSW 10 61905262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAATGGTGGATGGTGCATG -3'
(R):5'- AGCCGTTCGAAGGCTATCAG -3'

Sequencing Primer
(F):5'- AGCTGCATCCACAGGAAGCTG -3'
(R):5'- CGAAGGCTATCAGGACTGTTC -3'
Posted On2014-12-29