Incidental Mutation 'R2965:Dyrk2'
ID256032
Institutional Source Beutler Lab
Gene Symbol Dyrk2
Ensembl Gene ENSMUSG00000028630
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Synonyms1810038L18Rik
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.642) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location118855603-118870209 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 118860337 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 339 (K339*)
Ref Sequence ENSEMBL: ENSMUSP00000004281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004281]
Predicted Effect probably null
Transcript: ENSMUST00000004281
AA Change: K339*
SMART Domains Protein: ENSMUSP00000004281
Gene: ENSMUSG00000028630
AA Change: K339*

DomainStartEndE-ValueType
S_TKc 220 533 1.16e-92 SMART
low complexity region 560 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218692
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Ankar T C 1: 72,675,820 I382V probably benign Het
Anks1 A G 17: 28,053,905 T925A probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Fam187b A C 7: 30,977,729 D221A probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Ssrp1 A G 2: 85,041,586 T385A possibly damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in Dyrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dyrk2 APN 10 118859844 missense probably damaging 1.00
IGL00536:Dyrk2 APN 10 118860192 missense probably damaging 1.00
IGL01288:Dyrk2 APN 10 118860699 missense probably damaging 1.00
IGL01375:Dyrk2 APN 10 118860687 missense probably damaging 1.00
IGL01637:Dyrk2 APN 10 118860507 missense probably damaging 1.00
IGL02052:Dyrk2 APN 10 118860543 missense probably damaging 1.00
R0452:Dyrk2 UTSW 10 118868763 missense possibly damaging 0.91
R0833:Dyrk2 UTSW 10 118861122 missense probably benign 0.00
R0836:Dyrk2 UTSW 10 118861122 missense probably benign 0.00
R1346:Dyrk2 UTSW 10 118859719 missense possibly damaging 0.92
R1610:Dyrk2 UTSW 10 118859925 missense probably benign 0.02
R2397:Dyrk2 UTSW 10 118861368 intron probably benign
R2409:Dyrk2 UTSW 10 118860627 missense probably benign
R2966:Dyrk2 UTSW 10 118860337 nonsense probably null
R4700:Dyrk2 UTSW 10 118868286 missense probably benign
R4896:Dyrk2 UTSW 10 118868248 missense probably damaging 0.96
R4978:Dyrk2 UTSW 10 118860347 missense probably benign 0.00
R5393:Dyrk2 UTSW 10 118859848 missense probably damaging 0.98
R5442:Dyrk2 UTSW 10 118860738 missense possibly damaging 0.72
R5496:Dyrk2 UTSW 10 118860051 missense probably damaging 1.00
R5810:Dyrk2 UTSW 10 118860340 missense probably benign 0.16
R5875:Dyrk2 UTSW 10 118860697 missense probably damaging 1.00
R5930:Dyrk2 UTSW 10 118860268 missense probably damaging 1.00
R6877:Dyrk2 UTSW 10 118860423 missense probably damaging 1.00
R7234:Dyrk2 UTSW 10 118860231 missense possibly damaging 0.84
R7442:Dyrk2 UTSW 10 118859881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTATGGGCATGCCATACCTG -3'
(R):5'- TGGAACACCTACGGAAGCAG -3'

Sequencing Primer
(F):5'- ATACCTGGCTCCGAGGATCAC -3'
(R):5'- CACTATGAACGTCATCCACATGCTG -3'
Posted On2014-12-29