Mutagenetix > Incidental Mutation

Incidental Mutation 'R2965:Dyrk2'

256032

Institutional Source

Beutler Lab

Gene Symbol

Dyrk2

Ensembl Gene

ENSMUSG00000028630

Gene Name

dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2

Synonyms

1810038L18Rik

MMRRC Submission

040521-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.521) question?

Stock #

R2965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118855603-118870209 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 118860337 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 339 (K339*)

Ref Sequence

ENSEMBL: ENSMUSP00000004281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004281]

AlphaFold

Q5U4C9

Predicted Effect

probably null
Transcript: ENSMUST00000004281
AA Change: K339*

SMART Domains

Protein: ENSMUSP00000004281
Gene: ENSMUSG00000028630
AA Change: K339*

Domain	Start	End	E-Value	Type
S_TKc	220	533	1.16e-92	SMART
low complexity region	560	574	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191892

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218477

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218692

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	C	T	7: 41,626,405	R511*	probably null	Het
4930430A15Rik	A	T	2: 111,204,019	S359T	possibly damaging	Het
Add1	C	A	5: 34,630,714	D702E	probably benign	Het
Aff3	A	G	1: 38,209,710	I772T	probably damaging	Het
Ankar	T	C	1: 72,675,820	I382V	probably benign	Het
Anks1	A	G	17: 28,053,905	T925A	probably benign	Het
Asprv1	T	A	6: 86,628,366	C65S	probably damaging	Het
Atp8a1	T	C	5: 67,647,706	D1022G	probably benign	Het
Cep250	A	G	2: 155,994,878	K2256E	probably benign	Het
Chsy1	G	A	7: 66,172,164	G716R	probably damaging	Het
Cntln	T	C	4: 84,974,027		probably null	Het
Col13a1	G	A	10: 61,961,331	R106W	probably damaging	Het
Col2a1	A	G	15: 97,976,095	I1402T	unknown	Het
Col4a3	T	C	1: 82,648,600	L86P	unknown	Het
Cul9	A	G	17: 46,502,228	V2355A	probably damaging	Het
Ddx43	C	A	9: 78,406,379	Y197*	probably null	Het
Dnah7b	T	A	1: 46,207,572	I1636N	probably damaging	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Fam187b	A	C	7: 30,977,729	D221A	probably benign	Het
Fbxw21	A	G	9: 109,145,510	I314T	probably benign	Het
Fgd6	T	A	10: 94,044,194	F303L	probably benign	Het
Fstl3	T	C	10: 79,781,223	V200A	probably benign	Het
Gm10784	A	T	13: 49,945,197		noncoding transcript	Het
Gpr45	G	A	1: 43,032,508	D104N	possibly damaging	Het
Gria1	C	T	11: 57,185,801	Q8*	probably null	Het
H2-T22	A	G	17: 36,040,645	L231S	probably damaging	Het
Ice1	A	T	13: 70,602,578	D1796E	probably benign	Het
Ing1	T	A	8: 11,561,641	S26R	probably benign	Het
Klhl2	C	T	8: 64,752,760	V376M	probably benign	Het
Lrriq1	A	G	10: 103,214,900	S664P	probably benign	Het
Ltf	G	T	9: 111,028,472	C443F	possibly damaging	Het
Mgam	T	C	6: 40,768,220	V1807A	possibly damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Mycbp2	A	G	14: 103,297,358	V304A	probably benign	Het
Nek10	T	C	14: 14,836,202	L141P	probably damaging	Het
Noa1	T	C	5: 77,306,344	E483G	possibly damaging	Het
Olfr1453	C	T	19: 13,028,048	A94T	probably benign	Het
Pkd1l1	T	A	11: 8,874,236	S1110C	probably damaging	Het
Ppp4r4	T	C	12: 103,612,821	S873P	probably damaging	Het
Prss35	A	G	9: 86,755,582	D135G	probably damaging	Het
Pth	T	C	7: 113,385,929	H79R	probably benign	Het
Rab21	T	C	10: 115,294,909	N164S	probably benign	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Het
Slc4a5	C	T	6: 83,296,669	T997I	probably damaging	Het
Ssrp1	A	G	2: 85,041,586	T385A	possibly damaging	Het
Tcf15	T	C	2: 152,143,951	I109T	probably damaging	Het
Tcp11	C	A	17: 28,069,265	D330Y	probably benign	Het
Tktl2	T	A	8: 66,512,063	V91E	probably benign	Het
Usp48	G	A	4: 137,613,762	V358M	probably damaging	Het
Vmn1r228	A	G	17: 20,776,347	I303T	probably damaging	Het
Zfp229	T	G	17: 21,746,029	H413Q	probably damaging	Het

Other mutations in Dyrk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dyrk2	APN	10	118859844	missense	probably damaging	1.00
IGL00536:Dyrk2	APN	10	118860192	missense	probably damaging	1.00
IGL01288:Dyrk2	APN	10	118860699	missense	probably damaging	1.00
IGL01375:Dyrk2	APN	10	118860687	missense	probably damaging	1.00
IGL01637:Dyrk2	APN	10	118860507	missense	probably damaging	1.00
IGL02052:Dyrk2	APN	10	118860543	missense	probably damaging	1.00
R0452:Dyrk2	UTSW	10	118868763	missense	possibly damaging	0.91
R0833:Dyrk2	UTSW	10	118861122	missense	probably benign	0.00
R0836:Dyrk2	UTSW	10	118861122	missense	probably benign	0.00
R1346:Dyrk2	UTSW	10	118859719	missense	possibly damaging	0.92
R1610:Dyrk2	UTSW	10	118859925	missense	probably benign	0.02
R2397:Dyrk2	UTSW	10	118861368	intron	probably benign
R2409:Dyrk2	UTSW	10	118860627	missense	probably benign
R2966:Dyrk2	UTSW	10	118860337	nonsense	probably null
R4700:Dyrk2	UTSW	10	118868286	missense	probably benign
R4896:Dyrk2	UTSW	10	118868248	missense	probably damaging	0.96
R4978:Dyrk2	UTSW	10	118860347	missense	probably benign	0.00
R5393:Dyrk2	UTSW	10	118859848	missense	probably damaging	0.98
R5442:Dyrk2	UTSW	10	118860738	missense	possibly damaging	0.72
R5496:Dyrk2	UTSW	10	118860051	missense	probably damaging	1.00
R5810:Dyrk2	UTSW	10	118860340	missense	probably benign	0.16
R5875:Dyrk2	UTSW	10	118860697	missense	probably damaging	1.00
R5930:Dyrk2	UTSW	10	118860268	missense	probably damaging	1.00
R6877:Dyrk2	UTSW	10	118860423	missense	probably damaging	1.00
R7234:Dyrk2	UTSW	10	118860231	missense	possibly damaging	0.84
R7442:Dyrk2	UTSW	10	118859881	missense	probably damaging	1.00
R7741:Dyrk2	UTSW	10	118859689	missense	probably benign
R8108:Dyrk2	UTSW	10	118859829	missense	probably benign	0.27
R8137:Dyrk2	UTSW	10	118859884	missense	probably benign	0.00
R8347:Dyrk2	UTSW	10	118859983	missense	probably damaging	0.99
R8507:Dyrk2	UTSW	10	118860662	missense	probably damaging	1.00
R8517:Dyrk2	UTSW	10	118861021	missense	probably benign
R8695:Dyrk2	UTSW	10	118861017	missense	probably benign	0.00
R9018:Dyrk2	UTSW	10	118860109	missense	probably damaging	0.99
R9619:Dyrk2	UTSW	10	118860387	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTATGGGCATGCCATACCTG -3'
(R):5'- TGGAACACCTACGGAAGCAG -3'

Sequencing Primer
(F):5'- ATACCTGGCTCCGAGGATCAC -3'
(R):5'- CACTATGAACGTCATCCACATGCTG -3'

Posted On

2014-12-29