Incidental Mutation 'R0322:Tnfsf8'
ID25604
Institutional Source Beutler Lab
Gene Symbol Tnfsf8
Ensembl Gene ENSMUSG00000028362
Gene Nametumor necrosis factor (ligand) superfamily, member 8
SynonymsCD153, CD30LG, Cd30L
MMRRC Submission 038532-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0322 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location63831308-63861347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63834166 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 221 (T221A)
Ref Sequence ENSEMBL: ENSMUSP00000030047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030047]
Predicted Effect probably damaging
Transcript: ENSMUST00000030047
AA Change: T221A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030047
Gene: ENSMUSG00000028362
AA Change: T221A

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
TNF 103 235 2.64e-27 SMART
Meta Mutation Damage Score 0.2149 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.8%
  • 20x: 84.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF8/CD30, which is a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. The engagement of this cytokine expressed on B cell surface plays an inhibitory role in modulating Ig class switch. This cytokine was shown to enhance cell proliferation of some lymphoma cell lines, while to induce cell death and reduce cell proliferation of other lymphoma cell lines. The pleiotropic biologic activities of this cytokine on different CD30+ lymphoma cell lines may play a pathophysiologic role in Hodgkin's and some non-Hodgkin's lymphomas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice diplay decreased susceptibility to graft versus host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,372 S275T possibly damaging Het
Adam34 G T 8: 43,651,921 T229N probably benign Het
Adgrb3 C A 1: 25,221,748 probably benign Het
Ankhd1 T A 18: 36,658,008 Y2478* probably null Het
Arl9 A G 5: 77,007,190 probably benign Het
Bub1b G A 2: 118,639,618 probably benign Het
Chl1 A T 6: 103,701,883 probably benign Het
Cobl T A 11: 12,267,072 E465V probably damaging Het
Cobll1 A T 2: 65,102,098 M520K possibly damaging Het
Dll3 A G 7: 28,296,368 V336A possibly damaging Het
Dnmbp T C 19: 43,854,846 H1193R probably damaging Het
Fbxo43 T C 15: 36,152,192 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gjc3 A T 5: 137,957,498 M175K possibly damaging Het
Gm9008 T C 6: 76,496,418 Y405C probably benign Het
Gpc5 T A 14: 115,399,151 N415K probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Il7r A T 15: 9,510,215 F251I probably benign Het
Insc A G 7: 114,792,265 E141G probably damaging Het
Itm2c C T 1: 85,907,030 T160M probably damaging Het
Mboat1 T C 13: 30,232,080 probably benign Het
Mdm2 G T 10: 117,702,204 H96Q possibly damaging Het
Mettl13 A G 1: 162,544,176 probably benign Het
Mfsd4b3 T C 10: 39,947,530 N245D probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Mymk A T 2: 27,067,406 L66Q probably damaging Het
Myo18a T C 11: 77,829,800 S767P probably damaging Het
Ndufa8 T C 2: 36,036,622 D134G probably benign Het
Noxa1 A G 2: 25,092,554 F83S probably damaging Het
Npc1l1 T A 11: 6,229,042 I123L probably benign Het
Ogdhl A G 14: 32,337,577 T394A probably benign Het
Olfr1193 T C 2: 88,678,667 S264P probably damaging Het
Olfr290 A G 7: 84,916,313 Y178C probably damaging Het
Pcdh20 T C 14: 88,468,947 T306A probably benign Het
Pcid2 G A 8: 13,090,775 probably benign Het
Phyhip G A 14: 70,463,396 V108M possibly damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Psmb4 A G 3: 94,886,091 Y160H probably benign Het
Riox2 A T 16: 59,489,389 K369* probably null Het
Sh3tc1 G A 5: 35,706,561 P761S possibly damaging Het
Slc6a3 T A 13: 73,560,926 V323D possibly damaging Het
Smg7 A G 1: 152,849,873 probably null Het
Srrt G A 5: 137,296,608 R370C probably damaging Het
Stc1 T C 14: 69,029,409 V7A probably benign Het
Svep1 G T 4: 58,057,996 probably benign Het
Tbpl2 A G 2: 24,094,979 V51A probably benign Het
Tecr A G 8: 83,572,243 Y248H probably damaging Het
Tenm3 A G 8: 48,236,912 probably benign Het
Tia1 C T 6: 86,420,387 A114V probably damaging Het
Tmprss11f A T 5: 86,591,416 M2K probably benign Het
Tubgcp5 G A 7: 55,814,978 G536S probably damaging Het
Tyr A T 7: 87,492,917 I145N probably benign Het
Ubr4 T A 4: 139,422,418 V1809E probably damaging Het
Vmn2r65 A T 7: 84,946,548 N309K probably benign Het
Other mutations in Tnfsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Tnfsf8 APN 4 63834510 splice site probably benign
P0045:Tnfsf8 UTSW 4 63851167 splice site probably benign
R1167:Tnfsf8 UTSW 4 63837086 missense possibly damaging 0.55
R3821:Tnfsf8 UTSW 4 63860890 missense probably benign 0.17
R3893:Tnfsf8 UTSW 4 63860959 missense possibly damaging 0.86
R4154:Tnfsf8 UTSW 4 63834358 missense probably benign 0.00
R4380:Tnfsf8 UTSW 4 63861027 nonsense probably null
R4597:Tnfsf8 UTSW 4 63837100 missense probably damaging 1.00
R7502:Tnfsf8 UTSW 4 63851161 missense probably damaging 1.00
R7740:Tnfsf8 UTSW 4 63834446 missense possibly damaging 0.70
R8062:Tnfsf8 UTSW 4 63861195 start gained probably benign
R8126:Tnfsf8 UTSW 4 63834186 missense possibly damaging 0.94
R8301:Tnfsf8 UTSW 4 63860878 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCCTGTTTGTGCATCTGAAGGAGAC -3'
(R):5'- AGTTCCTCGTGCAGTGCTCAAATC -3'

Sequencing Primer
(F):5'- GTGCATCTGAAGGAGACTCCAC -3'
(R):5'- CAGTGCTCAAATCATTCTGTGGAC -3'
Posted On2013-04-16