Incidental Mutation 'R2965:Anks1'
ID256043
Institutional Source Beutler Lab
Gene Symbol Anks1
Ensembl Gene ENSMUSG00000024219
Gene Nameankyrin repeat and SAM domain containing 1
SynonymsOdin
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27909340-28062600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28053905 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 925 (T925A)
Ref Sequence ENSEMBL: ENSMUSP00000110491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025058] [ENSMUST00000088027] [ENSMUST00000114842]
Predicted Effect probably benign
Transcript: ENSMUST00000025058
AA Change: T925A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025058
Gene: ENSMUSG00000024219
AA Change: T925A

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
low complexity region 1126 1135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088027
AA Change: T904A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085344
Gene: ENSMUSG00000024219
AA Change: T904A

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 144 173 1.88e-5 SMART
ANK 177 206 1.93e-2 SMART
ANK 210 239 1.64e-5 SMART
ANK 242 271 7.71e-2 SMART
low complexity region 398 418 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
SAM 688 757 3.2e-16 SMART
SAM 762 830 4.33e-13 SMART
Blast:PTB 840 898 2e-22 BLAST
PTB 932 1066 3.17e-43 SMART
low complexity region 1105 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114842
AA Change: T925A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110491
Gene: ENSMUSG00000024219
AA Change: T925A

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139173
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Ankar T C 1: 72,675,820 I382V probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fam187b A C 7: 30,977,729 D221A probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Ssrp1 A G 2: 85,041,586 T385A possibly damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in Anks1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Anks1 APN 17 28058416 missense possibly damaging 0.94
IGL00816:Anks1 APN 17 28059393 critical splice donor site probably null
IGL00940:Anks1 APN 17 28057354 missense probably damaging 1.00
IGL01306:Anks1 APN 17 27986253 missense probably damaging 1.00
IGL01485:Anks1 APN 17 28051584 missense probably damaging 1.00
IGL02059:Anks1 APN 17 28008046 missense possibly damaging 0.64
IGL02220:Anks1 APN 17 28054707 missense probably damaging 0.98
IGL02955:Anks1 APN 17 28054317 missense probably damaging 1.00
IGL03071:Anks1 APN 17 28008199 missense probably benign 0.37
ANU23:Anks1 UTSW 17 27986253 missense probably damaging 1.00
R0389:Anks1 UTSW 17 27995952 missense possibly damaging 0.68
R1221:Anks1 UTSW 17 28050642 missense possibly damaging 0.62
R1523:Anks1 UTSW 17 28051655 splice site probably null
R1639:Anks1 UTSW 17 28058306 missense probably damaging 1.00
R1816:Anks1 UTSW 17 27986573 missense probably damaging 1.00
R1981:Anks1 UTSW 17 27985121 missense probably damaging 1.00
R1982:Anks1 UTSW 17 27985121 missense probably damaging 1.00
R2041:Anks1 UTSW 17 28008414 missense probably damaging 1.00
R2099:Anks1 UTSW 17 27978491 critical splice donor site probably null
R2897:Anks1 UTSW 17 27985363 critical splice donor site probably null
R3624:Anks1 UTSW 17 27986288 missense probably damaging 0.99
R4671:Anks1 UTSW 17 28051578 missense probably benign 0.45
R4786:Anks1 UTSW 17 28052730 missense possibly damaging 0.93
R4871:Anks1 UTSW 17 27991377 missense probably benign 0.00
R4936:Anks1 UTSW 17 27988805 missense probably damaging 1.00
R5175:Anks1 UTSW 17 28042588 missense probably damaging 1.00
R5908:Anks1 UTSW 17 27996019 missense probably damaging 1.00
R5975:Anks1 UTSW 17 27991447 intron probably null
R6226:Anks1 UTSW 17 28057330 missense probably benign 0.01
R6306:Anks1 UTSW 17 28050639 missense probably damaging 1.00
R6332:Anks1 UTSW 17 28052735 missense probably benign
R6891:Anks1 UTSW 17 28057424 missense probably damaging 1.00
R6995:Anks1 UTSW 17 28054299 missense probably damaging 1.00
R7465:Anks1 UTSW 17 28054323 missense possibly damaging 0.48
R7502:Anks1 UTSW 17 28008140 missense possibly damaging 0.48
R7749:Anks1 UTSW 17 28038141 missense probably damaging 0.96
R8005:Anks1 UTSW 17 28059367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGCCGGATGGTGCTCAC -3'
(R):5'- CCCTGGTTTATTCTCAGGCTAG -3'

Sequencing Primer
(F):5'- ACCACGTGGCCTGTCATGTAC -3'
(R):5'- GCCTTGTGAGCAGTCCAAAGAC -3'
Posted On2014-12-29