Incidental Mutation 'R2969:Slc43a1'
ID256050
Institutional Source Beutler Lab
Gene Symbol Slc43a1
Ensembl Gene ENSMUSG00000027075
Gene Namesolute carrier family 43, member 1
SynonymsLat3, Pov1, PB39, 2610016F07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R2969 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84838850-84863594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84857335 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 395 (T395I)
Ref Sequence ENSEMBL: ENSMUSP00000107252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028469] [ENSMUST00000111624] [ENSMUST00000111625] [ENSMUST00000121114]
Predicted Effect probably damaging
Transcript: ENSMUST00000028469
AA Change: T412I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028469
Gene: ENSMUSG00000027075
AA Change: T412I

DomainStartEndE-ValueType
Pfam:MFS_1 60 542 6.2e-14 PFAM
transmembrane domain 559 581 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111624
AA Change: T369I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107251
Gene: ENSMUSG00000027075
AA Change: T369I

DomainStartEndE-ValueType
Pfam:MFS_1 16 499 3.7e-14 PFAM
transmembrane domain 516 538 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111625
AA Change: T395I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107252
Gene: ENSMUSG00000027075
AA Change: T395I

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
Pfam:MFS_1 49 524 2.7e-13 PFAM
transmembrane domain 542 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121114
AA Change: T369I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112642
Gene: ENSMUSG00000027075
AA Change: T369I

DomainStartEndE-ValueType
Pfam:MFS_1 16 499 3.7e-14 PFAM
transmembrane domain 516 538 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145004
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC43A1 belongs to the system L family of plasma membrane carrier proteins that transports large neutral amino acids (Babu et al., 2003 [PubMed 12930836]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 A G 10: 69,994,395 T137A probably damaging Het
Antxr2 A T 5: 98,030,416 L45* probably null Het
Armc1 T C 3: 19,134,860 S214G probably benign Het
Arsj T C 3: 126,439,372 I589T probably benign Het
C8a A G 4: 104,853,777 S230P probably damaging Het
Cnga3 A G 1: 37,261,078 Y331C probably damaging Het
Gm21976 A G 13: 98,287,282 Y33C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gtf2i A G 5: 134,251,892 V556A probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Ing4 A G 6: 125,047,325 K131E probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nap1l2 A T X: 103,185,648 D221E probably benign Het
Nepn A T 10: 52,400,887 R179* probably null Het
Nrxn3 G A 12: 89,354,471 C383Y probably damaging Het
Pfpl G T 19: 12,429,543 R386L probably benign Het
Rere A G 4: 150,570,216 K402E unknown Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r128 T A 7: 21,350,121 V250D probably damaging Het
Other mutations in Slc43a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02326:Slc43a1 APN 2 84849771 missense probably damaging 1.00
IGL02480:Slc43a1 APN 2 84839584 missense probably benign 0.02
IGL02740:Slc43a1 APN 2 84859750 missense probably damaging 1.00
IGL02972:Slc43a1 APN 2 84860118 missense probably damaging 1.00
IGL03046:Slc43a1 APN 2 84854553 unclassified probably benign
IGL03166:Slc43a1 APN 2 84857356 missense possibly damaging 0.91
R1470:Slc43a1 UTSW 2 84859676 splice site probably benign
R1982:Slc43a1 UTSW 2 84856889 missense possibly damaging 0.94
R2087:Slc43a1 UTSW 2 84849831 missense probably damaging 1.00
R2141:Slc43a1 UTSW 2 84840961 missense probably damaging 1.00
R6208:Slc43a1 UTSW 2 84856840 missense possibly damaging 0.54
R6362:Slc43a1 UTSW 2 84859784 missense probably damaging 1.00
R7341:Slc43a1 UTSW 2 84862934 missense probably damaging 1.00
R7768:Slc43a1 UTSW 2 84856871 missense probably damaging 1.00
R7776:Slc43a1 UTSW 2 84840853 missense probably damaging 1.00
R7859:Slc43a1 UTSW 2 84856876 missense possibly damaging 0.83
R8082:Slc43a1 UTSW 2 84856900 missense probably benign
R8240:Slc43a1 UTSW 2 84859823 missense possibly damaging 0.67
R8395:Slc43a1 UTSW 2 84840922 missense probably damaging 1.00
X0019:Slc43a1 UTSW 2 84855583 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GACTCATTCTCGTAGTCCTGGG -3'
(R):5'- ACAGGGAAGTGCATTGCTCTC -3'

Sequencing Primer
(F):5'- TAGTCCTGGGGTCCTGAGAAC -3'
(R):5'- GGAAGTGCATTGCTCTCTCAGAC -3'
Posted On2014-12-29