Incidental Mutation 'R2969:Armc1'
ID256051
Institutional Source Beutler Lab
Gene Symbol Armc1
Ensembl Gene ENSMUSG00000027599
Gene Namearmadillo repeat containing 1
Synonyms2310016N05Rik, C330014L16Rik, 2900046P06Rik, Arcp, 3110009G21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R2969 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location19131402-19163065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19134860 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 214 (S214G)
Ref Sequence ENSEMBL: ENSMUSP00000029125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029125]
Predicted Effect probably benign
Transcript: ENSMUST00000029125
AA Change: S214G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029125
Gene: ENSMUSG00000027599
AA Change: S214G

DomainStartEndE-ValueType
Pfam:Arm 27 68 1.1e-6 PFAM
SCOP:d1fvqa_ 142 203 6e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 A G 10: 69,994,395 T137A probably damaging Het
Antxr2 A T 5: 98,030,416 L45* probably null Het
Arsj T C 3: 126,439,372 I589T probably benign Het
C8a A G 4: 104,853,777 S230P probably damaging Het
Cnga3 A G 1: 37,261,078 Y331C probably damaging Het
Gm21976 A G 13: 98,287,282 Y33C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gtf2i A G 5: 134,251,892 V556A probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Ing4 A G 6: 125,047,325 K131E probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nap1l2 A T X: 103,185,648 D221E probably benign Het
Nepn A T 10: 52,400,887 R179* probably null Het
Nrxn3 G A 12: 89,354,471 C383Y probably damaging Het
Pfpl G T 19: 12,429,543 R386L probably benign Het
Rere A G 4: 150,570,216 K402E unknown Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc43a1 C T 2: 84,857,335 T395I probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r128 T A 7: 21,350,121 V250D probably damaging Het
Other mutations in Armc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Armc1 APN 3 19144420 missense probably benign 0.21
IGL01453:Armc1 APN 3 19144430 missense probably benign 0.03
IGL02012:Armc1 APN 3 19157537 missense possibly damaging 0.57
IGL02586:Armc1 APN 3 19134028 utr 3 prime probably benign
R0512:Armc1 UTSW 3 19149495 missense possibly damaging 0.87
R1694:Armc1 UTSW 3 19134886 missense possibly damaging 0.81
R1878:Armc1 UTSW 3 19157544 missense probably damaging 1.00
R1881:Armc1 UTSW 3 19134896 missense possibly damaging 0.76
R2191:Armc1 UTSW 3 19134061 missense probably damaging 1.00
R2264:Armc1 UTSW 3 19134869 missense probably damaging 1.00
R2403:Armc1 UTSW 3 19157676 start gained probably benign
R3861:Armc1 UTSW 3 19135032 missense probably damaging 1.00
R4296:Armc1 UTSW 3 19149516 missense probably damaging 0.99
R6753:Armc1 UTSW 3 19144398 missense possibly damaging 0.86
R6891:Armc1 UTSW 3 19135041 missense probably damaging 1.00
R7837:Armc1 UTSW 3 19144469 missense probably benign 0.01
R8373:Armc1 UTSW 3 19149567 missense probably damaging 1.00
Z1088:Armc1 UTSW 3 19149507 missense probably damaging 1.00
Z1177:Armc1 UTSW 3 19149574 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGTTCGCCTTACAAGAGCACC -3'
(R):5'- CTGTTCAAAGATGCGTGGTG -3'

Sequencing Primer
(F):5'- TTACAAGAGCACCCTGAACTTCAG -3'
(R):5'- GCGGATCCGTTCAGACTTGAAG -3'
Posted On2014-12-29