Mutagenetix > Incidental Mutation

Incidental Mutation 'R2969:Rere'

256053

Institutional Source

Beutler Lab

Gene Symbol

Rere

Ensembl Gene

ENSMUSG00000039852

Gene Name

arginine glutamic acid dipeptide (RE) repeats

Synonyms

eye, eyes3, Atr2, atrophin-2, 1110033A15Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2969 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

150366103-150706423 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 150654673 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 402 (K402E)

Ref Sequence

ENSEMBL: ENSMUSP00000101307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105680] [ENSMUST00000105682]

AlphaFold

Q80TZ9

Predicted Effect

unknown
Transcript: ENSMUST00000105680
AA Change: K134E

SMART Domains

Protein: ENSMUSP00000101305
Gene: ENSMUSG00000039852
AA Change: K134E

Domain	Start	End	E-Value	Type
ELM2	18	70	1.67e-13	SMART
SANT	124	173	1.8e-6	SMART
low complexity region	176	193	N/A	INTRINSIC
ZnF_GATA	233	284	1.94e-15	SMART
Pfam:Atrophin-1	300	1290	N/A	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000105682
AA Change: K402E

SMART Domains

Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: K402E

Domain	Start	End	E-Value	Type
low complexity region	3	31	N/A	INTRINSIC
low complexity region	52	65	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
BAH	103	283	3.52e-13	SMART
ELM2	286	338	1.67e-13	SMART
SANT	392	441	1.8e-6	SMART
low complexity region	444	461	N/A	INTRINSIC
ZnF_GATA	501	552	1.94e-15	SMART
Pfam:Atrophin-1	568	1557	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137112

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142379

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	A	G	10: 69,830,225 (GRCm39)	T137A	probably damaging	Het
Antxr2	A	T	5: 98,178,275 (GRCm39)	L45*	probably null	Het
Armc1	T	C	3: 19,189,024 (GRCm39)	S214G	probably benign	Het
Arsj	T	C	3: 126,233,021 (GRCm39)	I589T	probably benign	Het
C8a	A	G	4: 104,710,974 (GRCm39)	S230P	probably damaging	Het
Cnga3	A	G	1: 37,300,159 (GRCm39)	Y331C	probably damaging	Het
Gm21976	A	G	13: 98,423,790 (GRCm39)	Y33C	unknown	Het
Gpat4	G	A	8: 23,670,171 (GRCm39)	P286L	probably damaging	Het
Gtf2i	A	G	5: 134,280,746 (GRCm39)	V556A	probably damaging	Het
Ighv8-12	C	T	12: 115,611,570 (GRCm39)	R118Q	probably benign	Het
Ing4	A	G	6: 125,024,288 (GRCm39)	K131E	probably benign	Het
Mrgprb5	T	A	7: 47,818,317 (GRCm39)	R139S	probably damaging	Het
Nap1l2	A	T	X: 102,229,254 (GRCm39)	D221E	probably benign	Het
Nepn	A	T	10: 52,276,983 (GRCm39)	R179*	probably null	Het
Nrxn3	G	A	12: 89,321,241 (GRCm39)	C383Y	probably damaging	Het
Pfpl	G	T	19: 12,406,907 (GRCm39)	R386L	probably benign	Het
Serpina3n	C	T	12: 104,375,333 (GRCm39)	T135M	probably benign	Het
Slc43a1	C	T	2: 84,687,679 (GRCm39)	T395I	probably damaging	Het
Tmem59l	A	G	8: 70,939,951 (GRCm39)	L6S	unknown	Het
Vipas39	T	C	12: 87,289,345 (GRCm39)	N373S	probably benign	Het
Vmn1r128	T	A	7: 21,084,046 (GRCm39)	V250D	probably damaging	Het

Other mutations in Rere

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Rere	APN	4	150,703,920 (GRCm39)	missense	probably damaging	1.00
IGL01465:Rere	APN	4	150,594,451 (GRCm39)	missense	unknown
IGL01523:Rere	APN	4	150,700,012 (GRCm39)	missense	possibly damaging	0.93
IGL01688:Rere	APN	4	150,702,893 (GRCm39)	missense	probably damaging	1.00
IGL02057:Rere	APN	4	150,699,289 (GRCm39)	unclassified	probably benign
IGL02621:Rere	APN	4	150,698,269 (GRCm39)	unclassified	probably benign
IGL02672:Rere	APN	4	150,594,483 (GRCm39)	missense	unknown
R0116:Rere	UTSW	4	150,701,433 (GRCm39)	missense	probably benign	0.18
R0119:Rere	UTSW	4	150,699,779 (GRCm39)	unclassified	probably benign
R0344:Rere	UTSW	4	150,695,438 (GRCm39)	unclassified	probably benign
R0504:Rere	UTSW	4	150,699,779 (GRCm39)	unclassified	probably benign
R0630:Rere	UTSW	4	150,703,545 (GRCm39)	missense	probably damaging	1.00
R0961:Rere	UTSW	4	150,699,829 (GRCm39)	unclassified	probably benign
R1164:Rere	UTSW	4	150,619,341 (GRCm39)	missense	unknown
R1424:Rere	UTSW	4	150,701,495 (GRCm39)	missense	probably damaging	1.00
R1542:Rere	UTSW	4	150,700,399 (GRCm39)	missense	probably damaging	1.00
R1652:Rere	UTSW	4	150,696,522 (GRCm39)	unclassified	probably benign
R1953:Rere	UTSW	4	150,701,294 (GRCm39)	missense	probably damaging	1.00
R1959:Rere	UTSW	4	150,553,247 (GRCm39)	missense	probably benign	0.23
R1966:Rere	UTSW	4	150,701,330 (GRCm39)	missense	probably damaging	1.00
R1975:Rere	UTSW	4	150,700,190 (GRCm39)	missense	probably damaging	0.99
R2070:Rere	UTSW	4	150,699,047 (GRCm39)	unclassified	probably benign
R2115:Rere	UTSW	4	150,697,018 (GRCm39)	unclassified	probably benign
R2144:Rere	UTSW	4	150,701,388 (GRCm39)	missense	probably damaging	0.99
R2270:Rere	UTSW	4	150,561,837 (GRCm39)	missense	unknown
R3699:Rere	UTSW	4	150,561,819 (GRCm39)	critical splice acceptor site	probably null
R3723:Rere	UTSW	4	150,553,252 (GRCm39)	missense	probably damaging	1.00
R3826:Rere	UTSW	4	150,554,785 (GRCm39)	missense	probably benign	0.42
R4234:Rere	UTSW	4	150,701,862 (GRCm39)	missense	probably damaging	1.00
R4512:Rere	UTSW	4	150,561,909 (GRCm39)	missense	unknown
R4798:Rere	UTSW	4	150,699,624 (GRCm39)	unclassified	probably benign
R4883:Rere	UTSW	4	150,700,510 (GRCm39)	missense	probably damaging	0.98
R4914:Rere	UTSW	4	150,703,601 (GRCm39)	missense	probably damaging	1.00
R4916:Rere	UTSW	4	150,703,601 (GRCm39)	missense	probably damaging	1.00
R4917:Rere	UTSW	4	150,703,601 (GRCm39)	missense	probably damaging	1.00
R4918:Rere	UTSW	4	150,703,601 (GRCm39)	missense	probably damaging	1.00
R4966:Rere	UTSW	4	150,698,273 (GRCm39)	unclassified	probably benign
R5172:Rere	UTSW	4	150,654,726 (GRCm39)	missense	unknown
R5643:Rere	UTSW	4	150,701,700 (GRCm39)	missense	probably damaging	1.00
R6058:Rere	UTSW	4	150,553,255 (GRCm39)	missense	probably damaging	1.00
R7112:Rere	UTSW	4	150,491,061 (GRCm39)	missense	probably benign
R7173:Rere	UTSW	4	150,553,195 (GRCm39)	missense	probably damaging	1.00
R7190:Rere	UTSW	4	150,695,410 (GRCm39)	missense	unknown
R7699:Rere	UTSW	4	150,701,555 (GRCm39)	missense
R7990:Rere	UTSW	4	150,699,327 (GRCm39)	missense	unknown
R8070:Rere	UTSW	4	150,701,832 (GRCm39)	missense	probably damaging	1.00
R8101:Rere	UTSW	4	150,701,796 (GRCm39)	missense	probably damaging	1.00
R8103:Rere	UTSW	4	150,701,796 (GRCm39)	missense	probably damaging	1.00
R8215:Rere	UTSW	4	150,701,424 (GRCm39)	missense	possibly damaging	0.95
R8254:Rere	UTSW	4	150,697,129 (GRCm39)	missense	unknown
R8348:Rere	UTSW	4	150,703,653 (GRCm39)	missense	probably damaging	1.00
R8448:Rere	UTSW	4	150,703,653 (GRCm39)	missense	probably damaging	1.00
R8725:Rere	UTSW	4	150,701,792 (GRCm39)	nonsense	probably null
R8790:Rere	UTSW	4	150,593,332 (GRCm39)	missense	unknown
R8921:Rere	UTSW	4	150,696,471 (GRCm39)	missense	unknown
R8937:Rere	UTSW	4	150,699,331 (GRCm39)	unclassified	probably benign
R9345:Rere	UTSW	4	150,554,770 (GRCm39)	missense	probably damaging	0.99
R9377:Rere	UTSW	4	150,593,342 (GRCm39)	missense	unknown
R9490:Rere	UTSW	4	150,516,040 (GRCm39)	missense	probably benign	0.16
R9523:Rere	UTSW	4	150,703,636 (GRCm39)	missense	probably damaging	0.98
R9653:Rere	UTSW	4	150,516,010 (GRCm39)	missense	probably benign	0.28
R9657:Rere	UTSW	4	150,699,390 (GRCm39)	missense	unknown
Z1176:Rere	UTSW	4	150,553,240 (GRCm39)	missense	probably damaging	1.00
Z1177:Rere	UTSW	4	150,700,268 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TTTATTGCAACGCGGGCTG -3'
(R):5'- CCATTTCCTAAGCCCAGATTCG -3'

Sequencing Primer
(F):5'- CAGCTTGTGGTTCCCGAAG -3'
(R):5'- TCGAAGAAGCAGCAGGAGC -3'

Posted On

2014-12-29