Incidental Mutation 'R2969:Gtf2i'
ID256056
Institutional Source Beutler Lab
Gene Symbol Gtf2i
Ensembl Gene ENSMUSG00000060261
Gene Namegeneral transcription factor II I
SynonymsBAP-135, 6030441I21Rik, TFII-I
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2969 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location134237834-134314760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134251892 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 556 (V556A)
Ref Sequence ENSEMBL: ENSMUSP00000134440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059042] [ENSMUST00000082057] [ENSMUST00000111261] [ENSMUST00000172715] [ENSMUST00000173341] [ENSMUST00000173888] [ENSMUST00000174155] [ENSMUST00000174354] [ENSMUST00000174513] [ENSMUST00000174772]
Predicted Effect probably damaging
Transcript: ENSMUST00000059042
AA Change: V575A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049625
Gene: ENSMUSG00000060261
AA Change: V575A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.4e-34 PFAM
low complexity region 328 338 N/A INTRINSIC
Pfam:GTF2I 361 436 3.4e-33 PFAM
Pfam:GTF2I 466 541 5e-34 PFAM
Pfam:GTF2I 571 646 3.3e-33 PFAM
Pfam:GTF2I 733 808 3.9e-33 PFAM
Pfam:GTF2I 868 943 9.4e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082057
AA Change: V554A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080714
Gene: ENSMUSG00000060261
AA Change: V554A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 307 317 N/A INTRINSIC
Pfam:GTF2I 340 415 3.3e-33 PFAM
Pfam:GTF2I 445 520 4.9e-34 PFAM
Pfam:GTF2I 550 625 3.2e-33 PFAM
Pfam:GTF2I 712 787 3.8e-33 PFAM
Pfam:GTF2I 847 922 9.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111261
AA Change: V556A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106892
Gene: ENSMUSG00000060261
AA Change: V556A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 309 319 N/A INTRINSIC
Pfam:GTF2I 342 417 3.3e-33 PFAM
Pfam:GTF2I 447 522 4.9e-34 PFAM
Pfam:GTF2I 552 627 3.2e-33 PFAM
Pfam:GTF2I 714 789 3.8e-33 PFAM
Pfam:GTF2I 849 924 9.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172715
AA Change: V490A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134035
Gene: ENSMUSG00000060261
AA Change: V490A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 9.7e-35 PFAM
low complexity region 243 253 N/A INTRINSIC
Pfam:GTF2I 276 351 2.4e-33 PFAM
Pfam:GTF2I 381 456 3.6e-34 PFAM
Pfam:GTF2I 486 561 2.4e-33 PFAM
Pfam:GTF2I 648 723 2.8e-33 PFAM
Pfam:GTF2I 783 858 6.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172904
Predicted Effect possibly damaging
Transcript: ENSMUST00000173341
AA Change: V535A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133444
Gene: ENSMUSG00000060261
AA Change: V535A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1e-34 PFAM
low complexity region 288 298 N/A INTRINSIC
Pfam:GTF2I 321 396 2.6e-33 PFAM
Pfam:GTF2I 426 501 3.8e-34 PFAM
Pfam:GTF2I 531 606 2.5e-33 PFAM
Pfam:GTF2I 693 768 3e-33 PFAM
Pfam:GTF2I 832 907 7.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173888
AA Change: V516A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133969
Gene: ENSMUSG00000060261
AA Change: V516A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 245 258 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
Pfam:GTF2I 302 377 3.2e-33 PFAM
Pfam:GTF2I 407 482 4.6e-34 PFAM
Pfam:GTF2I 512 587 3.1e-33 PFAM
Pfam:GTF2I 674 749 3.6e-33 PFAM
Pfam:GTF2I 809 884 8.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174133
SMART Domains Protein: ENSMUSP00000134111
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
Pfam:GTF2I 96 170 2.7e-32 PFAM
low complexity region 209 225 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
Pfam:GTF2I 279 353 5.1e-31 PFAM
Pfam:GTF2I 384 437 2.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174155
AA Change: V575A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133566
Gene: ENSMUSG00000060261
AA Change: V575A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 186 1.6e-34 PFAM
low complexity region 328 338 N/A INTRINSIC
Pfam:GTF2I 361 435 3e-33 PFAM
Pfam:GTF2I 466 540 9.1e-34 PFAM
Pfam:GTF2I 571 645 1.8e-32 PFAM
Pfam:GTF2I 733 807 2.2e-33 PFAM
Pfam:GTF2I 868 942 6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174182
Predicted Effect probably damaging
Transcript: ENSMUST00000174354
AA Change: V556A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134440
Gene: ENSMUSG00000060261
AA Change: V556A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 309 319 N/A INTRINSIC
Pfam:GTF2I 342 417 3.3e-33 PFAM
Pfam:GTF2I 447 522 4.9e-34 PFAM
Pfam:GTF2I 552 627 3.2e-33 PFAM
Pfam:GTF2I 714 789 3.8e-33 PFAM
Pfam:GTF2I 849 924 9.1e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174513
AA Change: V535A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133489
Gene: ENSMUSG00000060261
AA Change: V535A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 288 298 N/A INTRINSIC
Pfam:GTF2I 321 396 3.2e-33 PFAM
Pfam:GTF2I 426 501 4.8e-34 PFAM
Pfam:GTF2I 531 606 3.2e-33 PFAM
Pfam:GTF2I 693 768 3.7e-33 PFAM
Pfam:GTF2I 828 903 8.9e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174772
AA Change: V554A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133740
Gene: ENSMUSG00000060261
AA Change: V554A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 307 317 N/A INTRINSIC
Pfam:GTF2I 340 415 3.3e-33 PFAM
Pfam:GTF2I 445 520 4.9e-34 PFAM
Pfam:GTF2I 550 625 3.2e-33 PFAM
Pfam:GTF2I 712 787 3.8e-33 PFAM
Pfam:GTF2I 847 922 9.1e-30 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein containing six characteristic repeat motifs. The encoded protein binds to the initiator element (Inr) and E-box element in promoters and functions as a regulator of transcription. This locus, along with several other neighboring genes, is deleted in Williams-Beuren syndrome. There are many closely related genes and pseudogenes for this gene on chromosome 7. This gene also has pseudogenes on chromosomes 9, 13, and 21. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for null allele is embryonic lethal, and show brain hemorrhage and neural tube defects. Although most heterozygote are normal and fertile, at low frequency, growth retardation and small head are also reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 A G 10: 69,994,395 T137A probably damaging Het
Antxr2 A T 5: 98,030,416 L45* probably null Het
Armc1 T C 3: 19,134,860 S214G probably benign Het
Arsj T C 3: 126,439,372 I589T probably benign Het
C8a A G 4: 104,853,777 S230P probably damaging Het
Cnga3 A G 1: 37,261,078 Y331C probably damaging Het
Gm21976 A G 13: 98,287,282 Y33C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Ing4 A G 6: 125,047,325 K131E probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nap1l2 A T X: 103,185,648 D221E probably benign Het
Nepn A T 10: 52,400,887 R179* probably null Het
Nrxn3 G A 12: 89,354,471 C383Y probably damaging Het
Pfpl G T 19: 12,429,543 R386L probably benign Het
Rere A G 4: 150,570,216 K402E unknown Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc43a1 C T 2: 84,857,335 T395I probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r128 T A 7: 21,350,121 V250D probably damaging Het
Other mutations in Gtf2i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Gtf2i APN 5 134242748 missense probably damaging 1.00
IGL01565:Gtf2i APN 5 134255913 missense probably damaging 0.97
IGL01743:Gtf2i APN 5 134286893 missense probably damaging 1.00
IGL01809:Gtf2i APN 5 134249950 missense probably damaging 1.00
IGL02553:Gtf2i APN 5 134245161 missense probably damaging 1.00
IGL02814:Gtf2i APN 5 134286704 missense probably damaging 1.00
IGL02869:Gtf2i APN 5 134279427 splice site probably benign
IGL03018:Gtf2i APN 5 134289335 missense possibly damaging 0.79
IGL03051:Gtf2i APN 5 134242914 nonsense probably null
P0041:Gtf2i UTSW 5 134244888 splice site probably benign
R0330:Gtf2i UTSW 5 134251886 missense probably damaging 0.98
R0515:Gtf2i UTSW 5 134242919 missense probably damaging 1.00
R0529:Gtf2i UTSW 5 134261869 nonsense probably null
R0594:Gtf2i UTSW 5 134242173 splice site probably benign
R0650:Gtf2i UTSW 5 134261837 splice site probably benign
R1055:Gtf2i UTSW 5 134263624 missense probably damaging 1.00
R1079:Gtf2i UTSW 5 134242894 splice site probably benign
R1916:Gtf2i UTSW 5 134246848 missense probably damaging 1.00
R3013:Gtf2i UTSW 5 134295504 splice site probably benign
R4392:Gtf2i UTSW 5 134260629 missense probably damaging 0.96
R4421:Gtf2i UTSW 5 134255037 missense possibly damaging 0.86
R4635:Gtf2i UTSW 5 134245174 missense probably damaging 1.00
R4763:Gtf2i UTSW 5 134255964 missense probably damaging 1.00
R4770:Gtf2i UTSW 5 134243560 missense possibly damaging 0.53
R5063:Gtf2i UTSW 5 134260571 missense probably damaging 1.00
R5195:Gtf2i UTSW 5 134244832 nonsense probably null
R5829:Gtf2i UTSW 5 134263693 missense probably damaging 1.00
R6005:Gtf2i UTSW 5 134255958 nonsense probably null
R6119:Gtf2i UTSW 5 134287057 splice site probably null
R6576:Gtf2i UTSW 5 134263702 missense probably damaging 1.00
R6936:Gtf2i UTSW 5 134242785 missense probably damaging 1.00
R7070:Gtf2i UTSW 5 134282803 missense probably damaging 1.00
R7071:Gtf2i UTSW 5 134263621 missense probably damaging 1.00
R7142:Gtf2i UTSW 5 134244851 missense possibly damaging 0.95
R7366:Gtf2i UTSW 5 134265749 missense probably damaging 1.00
R7694:Gtf2i UTSW 5 134282805 missense probably damaging 1.00
R7879:Gtf2i UTSW 5 134266617 missense possibly damaging 0.77
R8039:Gtf2i UTSW 5 134255834 missense possibly damaging 0.95
R8041:Gtf2i UTSW 5 134293745 critical splice donor site probably null
R8154:Gtf2i UTSW 5 134251867 missense probably benign 0.07
R8365:Gtf2i UTSW 5 134274580 missense probably benign 0.22
X0022:Gtf2i UTSW 5 134263616 missense probably damaging 1.00
Z1176:Gtf2i UTSW 5 134263645 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGGAGCTTGGTTTAAGG -3'
(R):5'- AACACAGTAGAAACGTGCCTG -3'

Sequencing Primer
(F):5'- AGCTTGGTTTAAGGAGTGAGCTGAC -3'
(R):5'- AAACGTGCCTGGAGTCTG -3'
Posted On2014-12-29