Incidental Mutation 'R2969:Ing4'
ID256057
Institutional Source Beutler Lab
Gene Symbol Ing4
Ensembl Gene ENSMUSG00000030330
Gene Nameinhibitor of growth family, member 4
Synonymsp29ING4, D6Wsu147e, D6Xrf92
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R2969 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125039760-125049265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125047325 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 131 (K131E)
Ref Sequence ENSEMBL: ENSMUSP00000121519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032480] [ENSMUST00000032481] [ENSMUST00000088294] [ENSMUST00000112413] [ENSMUST00000112414] [ENSMUST00000112417] [ENSMUST00000140131]
Predicted Effect probably benign
Transcript: ENSMUST00000032480
AA Change: S131G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032480
Gene: ENSMUSG00000030330
AA Change: S131G

DomainStartEndE-ValueType
Pfam:ING 5 107 5.5e-35 PFAM
low complexity region 118 131 N/A INTRINSIC
PHD 197 242 3.67e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032481
SMART Domains Protein: ENSMUSP00000032481
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 140 4.8e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088294
SMART Domains Protein: ENSMUSP00000085632
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.6e-139 PFAM
KAZAL 466 506 1.42e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112412
SMART Domains Protein: ENSMUSP00000108031
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 87 6.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112413
SMART Domains Protein: ENSMUSP00000108032
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 169 6.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112414
SMART Domains Protein: ENSMUSP00000108033
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.9e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112417
SMART Domains Protein: ENSMUSP00000108036
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 6.5e-35 PFAM
low complexity region 118 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133695
Predicted Effect probably benign
Transcript: ENSMUST00000140131
AA Change: K131E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000121519
Gene: ENSMUSG00000030330
AA Change: K131E

DomainStartEndE-ValueType
Pfam:ING 6 107 2.1e-35 PFAM
low complexity region 114 139 N/A INTRINSIC
PHD 198 243 3.67e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140883
SMART Domains Protein: ENSMUSP00000118561
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151125
SMART Domains Protein: ENSMUSP00000119709
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1.4e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
PDB:1WEU|A 167 216 3e-32 PDB
SCOP:d1fp0a1 190 216 2e-3 SMART
Blast:PHD 197 215 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205110
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in the TP53-dependent regulatory pathway. Multiple alternatively spliced transcript variants have been observed that encode distinct proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are hypersensitive to LPS challenge and exhibit elevated cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 A G 10: 69,994,395 T137A probably damaging Het
Antxr2 A T 5: 98,030,416 L45* probably null Het
Armc1 T C 3: 19,134,860 S214G probably benign Het
Arsj T C 3: 126,439,372 I589T probably benign Het
C8a A G 4: 104,853,777 S230P probably damaging Het
Cnga3 A G 1: 37,261,078 Y331C probably damaging Het
Gm21976 A G 13: 98,287,282 Y33C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gtf2i A G 5: 134,251,892 V556A probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nap1l2 A T X: 103,185,648 D221E probably benign Het
Nepn A T 10: 52,400,887 R179* probably null Het
Nrxn3 G A 12: 89,354,471 C383Y probably damaging Het
Pfpl G T 19: 12,429,543 R386L probably benign Het
Rere A G 4: 150,570,216 K402E unknown Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc43a1 C T 2: 84,857,335 T395I probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r128 T A 7: 21,350,121 V250D probably damaging Het
Other mutations in Ing4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Ing4 APN 6 125043986 missense possibly damaging 0.95
R0361:Ing4 UTSW 6 125047894 missense probably damaging 1.00
R0830:Ing4 UTSW 6 125043960 missense probably damaging 1.00
R4849:Ing4 UTSW 6 125043983 missense probably damaging 0.98
R4955:Ing4 UTSW 6 125048201 missense probably damaging 0.97
R4971:Ing4 UTSW 6 125043998 missense probably benign 0.01
R5141:Ing4 UTSW 6 125039874 missense probably benign
R5561:Ing4 UTSW 6 125047060 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGTTTTCCTTGATCGGAGCC -3'
(R):5'- ACTTCTTCTGGGCAGCCTTG -3'

Sequencing Primer
(F):5'- CTTGATCGGAGCCAGGCTTG -3'
(R):5'- TCCCTTTGGAACGGGCTCTG -3'
Posted On2014-12-29