Incidental Mutation 'R2969:Vmn1r128'
ID256058
Institutional Source Beutler Lab
Gene Symbol Vmn1r128
Ensembl Gene ENSMUSG00000095758
Gene Namevomeronasal 1 receptor 128
SynonymsGm8509
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2969 (G1)
Quality Score144
Status Not validated
Chromosome7
Chromosomal Location21349373-21350296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21350121 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 250 (V250D)
Ref Sequence ENSEMBL: ENSMUSP00000129433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169165]
Predicted Effect probably damaging
Transcript: ENSMUST00000169165
AA Change: V250D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129433
Gene: ENSMUSG00000095758
AA Change: V250D

DomainStartEndE-ValueType
Pfam:TAS2R 8 299 3.6e-16 PFAM
Pfam:7tm_1 31 288 3.8e-6 PFAM
Pfam:V1R 41 296 8.4e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 A G 10: 69,994,395 T137A probably damaging Het
Antxr2 A T 5: 98,030,416 L45* probably null Het
Armc1 T C 3: 19,134,860 S214G probably benign Het
Arsj T C 3: 126,439,372 I589T probably benign Het
C8a A G 4: 104,853,777 S230P probably damaging Het
Cnga3 A G 1: 37,261,078 Y331C probably damaging Het
Gm21976 A G 13: 98,287,282 Y33C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gtf2i A G 5: 134,251,892 V556A probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Ing4 A G 6: 125,047,325 K131E probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nap1l2 A T X: 103,185,648 D221E probably benign Het
Nepn A T 10: 52,400,887 R179* probably null Het
Nrxn3 G A 12: 89,354,471 C383Y probably damaging Het
Pfpl G T 19: 12,429,543 R386L probably benign Het
Rere A G 4: 150,570,216 K402E unknown Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc43a1 C T 2: 84,857,335 T395I probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Other mutations in Vmn1r128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Vmn1r128 APN 7 21350076 missense probably benign 0.01
IGL02169:Vmn1r128 APN 7 21350238 missense probably damaging 0.99
IGL02883:Vmn1r128 APN 7 21349515 missense probably benign 0.00
R1740:Vmn1r128 UTSW 7 21349944 missense probably benign 0.00
R4583:Vmn1r128 UTSW 7 21349719 missense possibly damaging 0.79
R4867:Vmn1r128 UTSW 7 21350014 missense possibly damaging 0.53
R5266:Vmn1r128 UTSW 7 21349403 missense probably benign 0.14
R5631:Vmn1r128 UTSW 7 21349375 start codon destroyed probably null 1.00
R6267:Vmn1r128 UTSW 7 21350296 makesense probably null
R7376:Vmn1r128 UTSW 7 21349743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATGATGCCACATTCATGAC -3'
(R):5'- TGAGCACCACACCTTGTTCATAC -3'

Sequencing Primer
(F):5'- GAATGCAGCACATCCTCA -3'
(R):5'- CCACACCTTGTTCATACAAAATGTTG -3'
Posted On2014-12-29