Incidental Mutation 'R2969:Mrgprb5'
ID256059
Institutional Source Beutler Lab
Gene Symbol Mrgprb5
Ensembl Gene ENSMUSG00000070551
Gene NameMAS-related GPR, member B5
SynonymsMrgB5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2969 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48167983-48169019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48168569 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 139 (R139S)
Ref Sequence ENSEMBL: ENSMUSP00000091953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094389]
Predicted Effect probably damaging
Transcript: ENSMUST00000094389
AA Change: R139S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091953
Gene: ENSMUSG00000070551
AA Change: R139S

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 217 1.4e-8 PFAM
Pfam:7tm_1 47 210 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 A G 10: 69,994,395 T137A probably damaging Het
Antxr2 A T 5: 98,030,416 L45* probably null Het
Armc1 T C 3: 19,134,860 S214G probably benign Het
Arsj T C 3: 126,439,372 I589T probably benign Het
C8a A G 4: 104,853,777 S230P probably damaging Het
Cnga3 A G 1: 37,261,078 Y331C probably damaging Het
Gm21976 A G 13: 98,287,282 Y33C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gtf2i A G 5: 134,251,892 V556A probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Ing4 A G 6: 125,047,325 K131E probably benign Het
Nap1l2 A T X: 103,185,648 D221E probably benign Het
Nepn A T 10: 52,400,887 R179* probably null Het
Nrxn3 G A 12: 89,354,471 C383Y probably damaging Het
Pfpl G T 19: 12,429,543 R386L probably benign Het
Rere A G 4: 150,570,216 K402E unknown Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc43a1 C T 2: 84,857,335 T395I probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r128 T A 7: 21,350,121 V250D probably damaging Het
Other mutations in Mrgprb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mrgprb5 APN 7 48168384 missense probably damaging 1.00
IGL01662:Mrgprb5 APN 7 48168424 missense probably benign 0.02
IGL01752:Mrgprb5 APN 7 48168667 missense probably benign 0.22
IGL02117:Mrgprb5 APN 7 48168994 utr 5 prime probably benign
IGL02866:Mrgprb5 APN 7 48168166 missense probably damaging 0.99
IGL03382:Mrgprb5 APN 7 48168694 missense probably benign 0.01
R0545:Mrgprb5 UTSW 7 48168885 missense probably benign 0.08
R1389:Mrgprb5 UTSW 7 48168330 missense probably damaging 1.00
R1939:Mrgprb5 UTSW 7 48168938 missense probably benign 0.00
R2277:Mrgprb5 UTSW 7 48168831 missense probably damaging 1.00
R2367:Mrgprb5 UTSW 7 48168599 nonsense probably null
R2912:Mrgprb5 UTSW 7 48168067 missense probably benign
R2968:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2970:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R3499:Mrgprb5 UTSW 7 48168913 missense probably benign 0.04
R3828:Mrgprb5 UTSW 7 48168091 missense probably benign 0.01
R4590:Mrgprb5 UTSW 7 48168061 missense probably benign 0.16
R4719:Mrgprb5 UTSW 7 48168778 missense probably damaging 1.00
R5263:Mrgprb5 UTSW 7 48168189 missense probably damaging 0.99
R5264:Mrgprb5 UTSW 7 48168048 missense probably benign 0.10
R5644:Mrgprb5 UTSW 7 48168207 missense probably benign 0.00
R6485:Mrgprb5 UTSW 7 48168777 missense probably damaging 0.99
R6713:Mrgprb5 UTSW 7 48168789 missense probably damaging 0.98
R7112:Mrgprb5 UTSW 7 48168907 missense probably benign
R7176:Mrgprb5 UTSW 7 48168311 missense possibly damaging 0.68
R7446:Mrgprb5 UTSW 7 48168504 missense possibly damaging 0.65
R7640:Mrgprb5 UTSW 7 48168259 missense probably benign 0.00
R7831:Mrgprb5 UTSW 7 48168249 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GATCATCTTGACCAACAGGGC -3'
(R):5'- GCTTGTGCTGATTTCTTGCAAC -3'

Sequencing Primer
(F):5'- TTGACCAACAGGGCCAGGC -3'
(R):5'- AACTTTGCACTCAGATTTTAGGTTCC -3'
Posted On2014-12-29