Incidental Mutation 'R2969:Nap1l2'
ID256073
Institutional Source Beutler Lab
Gene Symbol Nap1l2
Ensembl Gene ENSMUSG00000082229
Gene Namenucleosome assembly protein 1-like 2
SynonymsBpx
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2969 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location103184176-103186640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103185648 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 221 (D221E)
Ref Sequence ENSEMBL: ENSMUSP00000112677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121720]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000033688
SMART Domains Protein: ENSMUSP00000033688
Gene: ENSMUSG00000031325

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 31 249 3.55e-3 SMART
low complexity region 260 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121720
AA Change: D221E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112677
Gene: ENSMUSG00000082229
AA Change: D221E

DomainStartEndE-ValueType
low complexity region 48 74 N/A INTRINSIC
Pfam:NAP 110 411 3.6e-84 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is a member of the nucleosome assembly protein (NAP) family. The encoded protein represents a class of tissue-specific factors that interact with chromatin to regulate neuronal cell proliferation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Chimeric embryos with high contribution from heterozygous or homozygous null mutant ES cells exhibit severely abnormal neural tube development and die by embryonic day 14 (E14). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 A G 10: 69,994,395 T137A probably damaging Het
Antxr2 A T 5: 98,030,416 L45* probably null Het
Armc1 T C 3: 19,134,860 S214G probably benign Het
Arsj T C 3: 126,439,372 I589T probably benign Het
C8a A G 4: 104,853,777 S230P probably damaging Het
Cnga3 A G 1: 37,261,078 Y331C probably damaging Het
Gm21976 A G 13: 98,287,282 Y33C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gtf2i A G 5: 134,251,892 V556A probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Ing4 A G 6: 125,047,325 K131E probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nepn A T 10: 52,400,887 R179* probably null Het
Nrxn3 G A 12: 89,354,471 C383Y probably damaging Het
Pfpl G T 19: 12,429,543 R386L probably benign Het
Rere A G 4: 150,570,216 K402E unknown Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc43a1 C T 2: 84,857,335 T395I probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r128 T A 7: 21,350,121 V250D probably damaging Het
Other mutations in Nap1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Nap1l2 APN X 103185316 missense probably benign 0.01
Z1088:Nap1l2 UTSW X 103185196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGAGTGTGAAGCTGAGAG -3'
(R):5'- TCAATGCAGTCTATGAGCCC -3'

Sequencing Primer
(F):5'- TGTGAAGCTGAGAGGCTCC -3'
(R):5'- TGCAGTCTATGAGCCCACAGAAG -3'
Posted On2014-12-29