Incidental Mutation 'R2938:Lmod1'
ID256077
Institutional Source Beutler Lab
Gene Symbol Lmod1
Ensembl Gene ENSMUSG00000048096
Gene Nameleiomodin 1 (smooth muscle)
SynonymsD1, 9530015K06Rik, 64kD D1, 1D, SM-Lmod
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location135324807-135368065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135363916 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 170 (K170E)
Ref Sequence ENSEMBL: ENSMUSP00000061597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059352]
Predicted Effect probably benign
Transcript: ENSMUST00000059352
AA Change: K170E

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000061597
Gene: ENSMUSG00000048096
AA Change: K170E

DomainStartEndE-ValueType
Pfam:Tropomodulin 5 127 1e-19 PFAM
low complexity region 177 190 N/A INTRINSIC
low complexity region 202 220 N/A INTRINSIC
PDB:1IO0|A 296 467 5e-35 PDB
SCOP:d1a4ya_ 311 445 7e-5 SMART
low complexity region 469 483 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
WH2 569 588 1.05e-3 SMART
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The leiomodin 1 protein has a putative membrane-spanning region and 2 types of tandemly repeated blocks. The transcript is expressed in all tissues tested, with the highest levels in thyroid, eye muscle, skeletal muscle, and ovary. Increased expression of leiomodin 1 may be linked to Graves' disease and thyroid-associated ophthalmopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,894,733 I1775K probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdc6 A G 11: 98,910,760 I217V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Cstl1 T A 2: 148,751,057 I44N possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr792 T A 10: 129,540,615 F26Y probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Postn T A 3: 54,370,310 F242Y probably damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Lmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Lmod1 APN 1 135364478 missense probably benign 0.05
IGL01104:Lmod1 APN 1 135364784 missense probably damaging 1.00
IGL02606:Lmod1 APN 1 135364480 missense probably benign 0.09
IGL03373:Lmod1 APN 1 135364526 missense possibly damaging 0.90
R0513:Lmod1 UTSW 1 135325168 missense probably damaging 0.98
R1185:Lmod1 UTSW 1 135364229 missense probably benign
R1185:Lmod1 UTSW 1 135364229 missense probably benign
R1185:Lmod1 UTSW 1 135364229 missense probably benign
R1572:Lmod1 UTSW 1 135363933 missense probably benign 0.00
R1728:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1729:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1730:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1739:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1762:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1783:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1784:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1785:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1795:Lmod1 UTSW 1 135325124 missense probably damaging 1.00
R2044:Lmod1 UTSW 1 135364387 missense probably benign 0.00
R2355:Lmod1 UTSW 1 135364515 missense probably benign 0.28
R2568:Lmod1 UTSW 1 135363964 nonsense probably null
R2937:Lmod1 UTSW 1 135363916 missense probably benign 0.11
R6108:Lmod1 UTSW 1 135364111 missense probably benign 0.43
R6823:Lmod1 UTSW 1 135325167 missense probably damaging 0.98
R6872:Lmod1 UTSW 1 135365141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCCAGACAGGACTC -3'
(R):5'- AGAACCTATGCCCTCATCCTCT -3'

Sequencing Primer
(F):5'- GGACTCAGACCTGGGCAAG -3'
(R):5'- GTCTCCCGACTGTGTTTCTG -3'
Posted On2014-12-29