Incidental Mutation 'R2938:Cstl1'
ID256083
Institutional Source Beutler Lab
Gene Symbol Cstl1
Ensembl Gene ENSMUSG00000055177
Gene Namecystatin-like 1
Synonyms
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location148750358-148755433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148751057 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 44 (I44N)
Ref Sequence ENSEMBL: ENSMUSP00000105581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109952] [ENSMUST00000109954] [ENSMUST00000109955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109952
AA Change: I44N

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105578
Gene: ENSMUSG00000055177
AA Change: I44N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CY 29 138 5.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109954
SMART Domains Protein: ENSMUSP00000105580
Gene: ENSMUSG00000055177

DomainStartEndE-ValueType
Pfam:Cystatin 13 74 5.5e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109955
AA Change: I44N

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105581
Gene: ENSMUSG00000055177
AA Change: I44N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CY 29 138 5.52e-13 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located at the telomeric end of the cystatin locus and encodes a type 2 cystatin-like protein. The specific function of this protein has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,894,733 I1775K probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdc6 A G 11: 98,910,760 I217V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr792 T A 10: 129,540,615 F26Y probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Postn T A 3: 54,370,310 F242Y probably damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Cstl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Cstl1 UTSW 2 148755325 missense probably damaging 1.00
R0477:Cstl1 UTSW 2 148750988 missense probably benign 0.06
R1706:Cstl1 UTSW 2 148751159 splice site probably null
R2471:Cstl1 UTSW 2 148751121 nonsense probably null
R4005:Cstl1 UTSW 2 148755270 missense probably damaging 0.99
R5071:Cstl1 UTSW 2 148750927 start codon destroyed probably benign 0.01
R7019:Cstl1 UTSW 2 148755303 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAGAGAACTGTTGCTGCACTCG -3'
(R):5'- CCATTGCACATGAAGCTACCTG -3'

Sequencing Primer
(F):5'- ACTGTTGCTGCACTCGAAAGC -3'
(R):5'- CATGAAGCTACCTGAGGAGTTTCC -3'
Posted On2014-12-29