Incidental Mutation 'R2938:Arfgef2'
ID256084
Institutional Source Beutler Lab
Gene Symbol Arfgef2
Ensembl Gene ENSMUSG00000074582
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
SynonymsE230011G24Rik, BIG2
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location166805588-166898052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 166894733 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 1775 (I1775K)
Ref Sequence ENSEMBL: ENSMUSP00000096677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099078]
Predicted Effect probably damaging
Transcript: ENSMUST00000099078
AA Change: I1775K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096677
Gene: ENSMUSG00000074582
AA Change: I1775K

DomainStartEndE-ValueType
Pfam:DCB 7 200 1.6e-40 PFAM
Pfam:Sec7_N 377 536 3.7e-53 PFAM
Blast:Sec7 549 598 8e-18 BLAST
low complexity region 621 633 N/A INTRINSIC
Sec7 647 834 1.55e-97 SMART
Blast:Sec7 853 888 2e-11 BLAST
Blast:Sec7 902 941 4e-15 BLAST
low complexity region 1044 1055 N/A INTRINSIC
Pfam:DUF1981 1174 1257 6e-38 PFAM
low complexity region 1719 1729 N/A INTRINSIC
Meta Mutation Damage Score 0.5349 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exencephaly, midline gut closure defects, periventricular and subependymal heterotopia, and impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdc6 A G 11: 98,910,760 I217V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Cstl1 T A 2: 148,751,057 I44N possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr792 T A 10: 129,540,615 F26Y probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Postn T A 3: 54,370,310 F242Y probably damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Arfgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Arfgef2 APN 2 166885853 missense probably damaging 1.00
IGL01323:Arfgef2 APN 2 166871495 missense probably damaging 1.00
IGL01415:Arfgef2 APN 2 166867355 missense probably damaging 0.98
IGL01638:Arfgef2 APN 2 166873945 missense probably damaging 0.97
IGL02618:Arfgef2 APN 2 166853313 missense probably damaging 1.00
IGL02899:Arfgef2 APN 2 166869051 splice site probably benign
IGL03012:Arfgef2 APN 2 166868888 splice site probably benign
IGL03063:Arfgef2 APN 2 166859782 splice site probably benign
shimmering UTSW 2 166826928 missense probably benign
R0102:Arfgef2 UTSW 2 166845465 missense probably benign 0.00
R0102:Arfgef2 UTSW 2 166845465 missense probably benign 0.00
R0116:Arfgef2 UTSW 2 166873683 missense probably damaging 1.00
R0128:Arfgef2 UTSW 2 166835719 missense probably damaging 1.00
R0130:Arfgef2 UTSW 2 166835719 missense probably damaging 1.00
R0208:Arfgef2 UTSW 2 166867422 missense probably damaging 1.00
R0379:Arfgef2 UTSW 2 166860400 critical splice donor site probably null
R0945:Arfgef2 UTSW 2 166826969 unclassified probably benign
R1226:Arfgef2 UTSW 2 166827640 missense probably damaging 1.00
R1252:Arfgef2 UTSW 2 166859957 missense probably damaging 1.00
R1695:Arfgef2 UTSW 2 166864712 missense probably damaging 0.98
R1696:Arfgef2 UTSW 2 166861638 missense probably damaging 1.00
R1742:Arfgef2 UTSW 2 166866980 missense probably damaging 1.00
R1935:Arfgef2 UTSW 2 166863603 missense probably benign 0.28
R1936:Arfgef2 UTSW 2 166863603 missense probably benign 0.28
R1939:Arfgef2 UTSW 2 166873628 missense probably damaging 1.00
R2276:Arfgef2 UTSW 2 166865759 missense probably benign 0.00
R2279:Arfgef2 UTSW 2 166865759 missense probably benign 0.00
R2349:Arfgef2 UTSW 2 166852028 missense probably damaging 1.00
R2359:Arfgef2 UTSW 2 166860619 missense probably damaging 1.00
R2414:Arfgef2 UTSW 2 166845504 missense probably benign 0.00
R2519:Arfgef2 UTSW 2 166881244 missense probably benign 0.03
R3696:Arfgef2 UTSW 2 166853300 nonsense probably null
R4022:Arfgef2 UTSW 2 166873945 missense probably benign 0.01
R4227:Arfgef2 UTSW 2 166867324 missense probably damaging 1.00
R4293:Arfgef2 UTSW 2 166890291 missense probably benign
R4455:Arfgef2 UTSW 2 166894715 missense probably benign 0.43
R4499:Arfgef2 UTSW 2 166885814 missense probably damaging 0.99
R4570:Arfgef2 UTSW 2 166856538 missense probably damaging 0.99
R4888:Arfgef2 UTSW 2 166835613 missense probably damaging 1.00
R4893:Arfgef2 UTSW 2 166866956 missense probably benign
R5032:Arfgef2 UTSW 2 166878544 missense probably benign
R5191:Arfgef2 UTSW 2 166876511 missense probably damaging 1.00
R5200:Arfgef2 UTSW 2 166860684 missense probably benign 0.00
R5318:Arfgef2 UTSW 2 166873971 missense probably damaging 1.00
R5378:Arfgef2 UTSW 2 166873628 missense probably damaging 1.00
R5537:Arfgef2 UTSW 2 166856593 splice site probably null
R5866:Arfgef2 UTSW 2 166836257 missense possibly damaging 0.88
R5878:Arfgef2 UTSW 2 166870217 missense probably benign 0.41
R5972:Arfgef2 UTSW 2 166891836 missense probably damaging 1.00
R6147:Arfgef2 UTSW 2 166871495 missense probably damaging 1.00
R6293:Arfgef2 UTSW 2 166873588 missense possibly damaging 0.92
R6323:Arfgef2 UTSW 2 166834484 missense probably damaging 1.00
R6338:Arfgef2 UTSW 2 166845570 missense probably damaging 1.00
R6538:Arfgef2 UTSW 2 166893621 splice site probably null
R6726:Arfgef2 UTSW 2 166893620 critical splice donor site probably null
R7047:Arfgef2 UTSW 2 166851945 splice site probably null
R7086:Arfgef2 UTSW 2 166876616 missense probably damaging 1.00
R7108:Arfgef2 UTSW 2 166873608 missense possibly damaging 0.80
R7155:Arfgef2 UTSW 2 166865813 missense probably benign 0.19
R7159:Arfgef2 UTSW 2 166826928 missense probably benign
R7482:Arfgef2 UTSW 2 166851279 critical splice donor site probably null
R7598:Arfgef2 UTSW 2 166856524 missense probably benign
R7869:Arfgef2 UTSW 2 166873703 missense probably damaging 1.00
R7952:Arfgef2 UTSW 2 166873703 missense probably damaging 1.00
R8003:Arfgef2 UTSW 2 166853288
X0040:Arfgef2 UTSW 2 166859883 missense probably damaging 1.00
X0063:Arfgef2 UTSW 2 166891841 missense probably benign 0.32
Z1088:Arfgef2 UTSW 2 166893595 missense possibly damaging 0.78
Z1176:Arfgef2 UTSW 2 166894712
Predicted Primers PCR Primer
(F):5'- CATCTGGAAAACGGGTGCAG -3'
(R):5'- TTTAATGAGACACCATGAGCCTCC -3'

Sequencing Primer
(F):5'- GGTGCAGAAAGGAAGGTGTTC -3'
(R):5'- ACTGTGCTGACCAGGGTTCAC -3'
Posted On2014-12-29