Incidental Mutation 'R0322:Tia1'
List |< first << previous [record 50 of 56] next >> last >|
ID25610
Institutional Source Beutler Lab
Gene Symbol Tia1
Ensembl Gene ENSMUSG00000071337
Gene Namecytotoxic granule-associated RNA binding protein 1
Synonyms2310050N03Rik, mTIA-1
MMRRC Submission 038532-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R0322 (G1)
Quality Score193
Status Validated
Chromosome6
Chromosomal Location86404219-86433405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86420387 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 114 (A114V)
Ref Sequence ENSEMBL: ENSMUSP00000144857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095752] [ENSMUST00000095753] [ENSMUST00000095754] [ENSMUST00000113712] [ENSMUST00000113713] [ENSMUST00000130967] [ENSMUST00000148728] [ENSMUST00000154438]
Predicted Effect probably damaging
Transcript: ENSMUST00000095752
AA Change: A114V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093424
Gene: ENSMUSG00000071337
AA Change: A114V

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 271 2.25e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095753
AA Change: A125V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093425
Gene: ENSMUSG00000071337
AA Change: A125V

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095754
AA Change: A125V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093426
Gene: ENSMUSG00000071337
AA Change: A125V

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113708
SMART Domains Protein: ENSMUSP00000109338
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113712
AA Change: A125V

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138652
Gene: ENSMUSG00000071337
AA Change: A125V

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113713
AA Change: A116V

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109342
Gene: ENSMUSG00000071337
AA Change: A116V

DomainStartEndE-ValueType
RRM 8 81 1.62e-23 SMART
RRM 98 171 5.15e-26 SMART
RRM 206 273 2.25e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126404
Predicted Effect probably damaging
Transcript: ENSMUST00000130967
AA Change: A114V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118558
Gene: ENSMUSG00000071337
AA Change: A114V

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 258 1.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147104
Predicted Effect probably damaging
Transcript: ENSMUST00000148728
AA Change: A114V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144857
Gene: ENSMUSG00000071337
AA Change: A114V

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Pfam:RRM_1 97 131 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152852
Predicted Effect probably benign
Transcript: ENSMUST00000154438
SMART Domains Protein: ENSMUSP00000145218
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205109
Meta Mutation Damage Score 0.3521 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.8%
  • 20x: 84.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced postnatal survival and functional abnormalities in the immune system with no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,372 S275T possibly damaging Het
Adam34 G T 8: 43,651,921 T229N probably benign Het
Adgrb3 C A 1: 25,221,748 probably benign Het
Ankhd1 T A 18: 36,658,008 Y2478* probably null Het
Arl9 A G 5: 77,007,190 probably benign Het
Bub1b G A 2: 118,639,618 probably benign Het
Chl1 A T 6: 103,701,883 probably benign Het
Cobl T A 11: 12,267,072 E465V probably damaging Het
Cobll1 A T 2: 65,102,098 M520K possibly damaging Het
Dll3 A G 7: 28,296,368 V336A possibly damaging Het
Dnmbp T C 19: 43,854,846 H1193R probably damaging Het
Fbxo43 T C 15: 36,152,192 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gjc3 A T 5: 137,957,498 M175K possibly damaging Het
Gm9008 T C 6: 76,496,418 Y405C probably benign Het
Gpc5 T A 14: 115,399,151 N415K probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Il7r A T 15: 9,510,215 F251I probably benign Het
Insc A G 7: 114,792,265 E141G probably damaging Het
Itm2c C T 1: 85,907,030 T160M probably damaging Het
Mboat1 T C 13: 30,232,080 probably benign Het
Mdm2 G T 10: 117,702,204 H96Q possibly damaging Het
Mettl13 A G 1: 162,544,176 probably benign Het
Mfsd4b3 T C 10: 39,947,530 N245D probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Mymk A T 2: 27,067,406 L66Q probably damaging Het
Myo18a T C 11: 77,829,800 S767P probably damaging Het
Ndufa8 T C 2: 36,036,622 D134G probably benign Het
Noxa1 A G 2: 25,092,554 F83S probably damaging Het
Npc1l1 T A 11: 6,229,042 I123L probably benign Het
Ogdhl A G 14: 32,337,577 T394A probably benign Het
Olfr1193 T C 2: 88,678,667 S264P probably damaging Het
Olfr290 A G 7: 84,916,313 Y178C probably damaging Het
Pcdh20 T C 14: 88,468,947 T306A probably benign Het
Pcid2 G A 8: 13,090,775 probably benign Het
Phyhip G A 14: 70,463,396 V108M possibly damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Psmb4 A G 3: 94,886,091 Y160H probably benign Het
Riox2 A T 16: 59,489,389 K369* probably null Het
Sh3tc1 G A 5: 35,706,561 P761S possibly damaging Het
Slc6a3 T A 13: 73,560,926 V323D possibly damaging Het
Smg7 A G 1: 152,849,873 probably null Het
Srrt G A 5: 137,296,608 R370C probably damaging Het
Stc1 T C 14: 69,029,409 V7A probably benign Het
Svep1 G T 4: 58,057,996 probably benign Het
Tbpl2 A G 2: 24,094,979 V51A probably benign Het
Tecr A G 8: 83,572,243 Y248H probably damaging Het
Tenm3 A G 8: 48,236,912 probably benign Het
Tmprss11f A T 5: 86,591,416 M2K probably benign Het
Tnfsf8 T C 4: 63,834,166 T221A probably damaging Het
Tubgcp5 G A 7: 55,814,978 G536S probably damaging Het
Tyr A T 7: 87,492,917 I145N probably benign Het
Ubr4 T A 4: 139,422,418 V1809E probably damaging Het
Vmn2r65 A T 7: 84,946,548 N309K probably benign Het
Other mutations in Tia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02643:Tia1 APN 6 86416390 missense probably benign 0.16
R1118:Tia1 UTSW 6 86419109 missense probably benign 0.00
R1451:Tia1 UTSW 6 86430339 missense probably benign 0.00
R1631:Tia1 UTSW 6 86420348 missense probably damaging 1.00
R2275:Tia1 UTSW 6 86427677 missense probably benign 0.00
R2509:Tia1 UTSW 6 86424330 splice site probably null
R3952:Tia1 UTSW 6 86416337 missense probably damaging 1.00
R4596:Tia1 UTSW 6 86420407 missense probably benign 0.34
R4674:Tia1 UTSW 6 86420400 missense probably damaging 0.99
R4919:Tia1 UTSW 6 86424323 unclassified probably benign
R6339:Tia1 UTSW 6 86426656 missense probably damaging 1.00
R6455:Tia1 UTSW 6 86420378 missense probably damaging 1.00
R7139:Tia1 UTSW 6 86427688 missense possibly damaging 0.95
R7804:Tia1 UTSW 6 86424382 missense probably benign 0.02
R7879:Tia1 UTSW 6 86424365 missense probably damaging 0.97
R8018:Tia1 UTSW 6 86425052 missense probably benign 0.06
R8153:Tia1 UTSW 6 86420332 missense probably damaging 0.99
R8172:Tia1 UTSW 6 86427700 missense probably benign 0.38
R8275:Tia1 UTSW 6 86427736 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGCAACCAAAACTGTTGGCTTT -3'
(R):5'- ACTGTACTTGCTTTCAGACTCTTGGATG -3'

Sequencing Primer
(F):5'- TAGACAGTGACTACCAGCTTCTG -3'
(R):5'- TCAGACTCTTGGATGATCTCTAAAC -3'
Posted On2013-04-16