Incidental Mutation 'R2938:Csn1s1'
ID256100
Institutional Source Beutler Lab
Gene Symbol Csn1s1
Ensembl Gene ENSMUSG00000070702
Gene Namecasein alpha s1
SynonymsCsna
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87666208-87682578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87677136 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 221 (Q221L)
Ref Sequence ENSEMBL: ENSMUSP00000092225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094641] [ENSMUST00000197157] [ENSMUST00000197631] [ENSMUST00000199506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094641
AA Change: Q221L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092225
Gene: ENSMUSG00000070702
AA Change: Q221L

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 74 102 N/A INTRINSIC
internal_repeat_1 117 148 7.63e-5 PROSPERO
internal_repeat_1 141 172 7.63e-5 PROSPERO
low complexity region 173 198 N/A INTRINSIC
Pfam:Casein 215 304 5.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197157
SMART Domains Protein: ENSMUSP00000142839
Gene: ENSMUSG00000070702

DomainStartEndE-ValueType
low complexity region 16 44 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000197631
AA Change: Q221L
SMART Domains Protein: ENSMUSP00000142794
Gene: ENSMUSG00000070702
AA Change: Q221L

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 74 102 N/A INTRINSIC
internal_repeat_1 117 148 3.17e-5 PROSPERO
internal_repeat_1 141 172 3.17e-5 PROSPERO
low complexity region 173 198 N/A INTRINSIC
Pfam:Casein 215 282 4.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198432
Predicted Effect probably benign
Transcript: ENSMUST00000199506
SMART Domains Protein: ENSMUSP00000143694
Gene: ENSMUSG00000070702

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200344
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display reduced milk prodution and abnormal milk composition with reduced protein, calcium and phosphate concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,894,733 I1775K probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdc6 A G 11: 98,910,760 I217V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Cstl1 T A 2: 148,751,057 I44N possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr792 T A 10: 129,540,615 F26Y probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Postn T A 3: 54,370,310 F242Y probably damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Csn1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Csn1s1 APN 5 87667259 missense probably benign 0.03
IGL01984:Csn1s1 APN 5 87676510 unclassified probably benign
IGL02183:Csn1s1 APN 5 87677618 missense possibly damaging 0.52
IGL02335:Csn1s1 APN 5 87680845 missense probably benign 0.09
IGL02496:Csn1s1 APN 5 87677594 unclassified probably benign
IGL02502:Csn1s1 APN 5 87680925 missense probably benign 0.06
IGL02622:Csn1s1 APN 5 87677642 critical splice donor site probably null
IGL03403:Csn1s1 APN 5 87667293 missense probably benign 0.19
R0004:Csn1s1 UTSW 5 87671531 missense probably benign 0.01
R0472:Csn1s1 UTSW 5 87677627 missense possibly damaging 0.71
R1076:Csn1s1 UTSW 5 87676383 splice site probably null
R1364:Csn1s1 UTSW 5 87677584 unclassified probably benign
R1761:Csn1s1 UTSW 5 87679035 missense probably benign 0.32
R2056:Csn1s1 UTSW 5 87671528 missense possibly damaging 0.66
R2937:Csn1s1 UTSW 5 87677136 missense possibly damaging 0.52
R3793:Csn1s1 UTSW 5 87680843 nonsense probably null
R4274:Csn1s1 UTSW 5 87680961 makesense probably null
R4568:Csn1s1 UTSW 5 87680904 missense possibly damaging 0.51
R4959:Csn1s1 UTSW 5 87673261 missense probably benign 0.27
R4973:Csn1s1 UTSW 5 87673261 missense probably benign 0.27
R5133:Csn1s1 UTSW 5 87680878 missense possibly damaging 0.92
R5611:Csn1s1 UTSW 5 87677644 splice site probably null
R6008:Csn1s1 UTSW 5 87678085 critical splice donor site probably null
R6663:Csn1s1 UTSW 5 87675740 missense probably benign 0.33
R6940:Csn1s1 UTSW 5 87675023 missense possibly damaging 0.46
R7164:Csn1s1 UTSW 5 87674228 missense possibly damaging 0.53
R7998:Csn1s1 UTSW 5 87674228 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCTATGCTAGTAGAGAGTCTATGCC -3'
(R):5'- CTGTCATGCATAGTTAAGACACC -3'

Sequencing Primer
(F):5'- CACTATGCCAATACATACTCTATGTC -3'
(R):5'- GTTAAGACACCAAGATACTGTTACC -3'
Posted On2014-12-29