Mutagenetix > Incidental Mutations

Incidental Mutation 'R2938:Olfr792'

256117

Institutional Source

Beutler Lab

Gene Symbol

Olfr792

Ensembl Gene

ENSMUSG00000094496

Gene Name

olfactory receptor 792

Synonyms

GA_x6K02T2PULF-11219415-11220350, MOR108-2

MMRRC Submission

040515-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R2938 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129539162-129542534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 129540615 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 26 (F26Y)

Ref Sequence

ENSEMBL: ENSMUSP00000149872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076575] [ENSMUST00000215436]

Predicted Effect

probably damaging
Transcript: ENSMUST00000076575
AA Change: F26Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000096707
Gene: ENSMUSG00000094496
AA Change: F26Y

Domain	Start	End	E-Value	Type
Pfam:7tm_4	28	306	1.9e-53	PFAM
Pfam:7tm_1	39	288	4.7e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215436
AA Change: F26Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arfgef2	T	A	2: 166,894,733	I1775K	probably damaging	Het
Arhgap45	T	A	10: 80,029,002	M933K	probably damaging	Het
Astn2	A	T	4: 65,992,313	H427Q	possibly damaging	Het
Bace2	T	C	16: 97,412,188		probably null	Het
Cacna1b	A	G	2: 24,606,528	V125A	probably benign	Het
Cbarp	T	C	10: 80,131,769	D539G	probably damaging	Het
Ccdc59	A	T	10: 105,841,527	K9M	possibly damaging	Het
Ccdc73	T	A	2: 104,975,635	L296*	probably null	Het
Cd40	G	C	2: 165,069,702	V191L	probably benign	Het
Cdc6	A	G	11: 98,910,760	I217V	probably benign	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cdr1	T	G	X: 61,185,362	D66A	unknown	Het
Cela3b	A	G	4: 137,423,263	I208T	probably benign	Het
Col1a2	A	T	6: 4,520,788	Q375L	possibly damaging	Het
Csn1s1	A	T	5: 87,677,136	Q221L	possibly damaging	Het
Cstl1	T	A	2: 148,751,057	I44N	possibly damaging	Het
Depdc5	G	A	5: 32,901,621		probably null	Het
Dthd1	A	G	5: 62,842,957	I541V	probably benign	Het
Eml6	G	A	11: 29,833,049		probably benign	Het
Fkbp15	T	A	4: 62,304,663	T1000S	probably benign	Het
Gimap8	A	T	6: 48,658,796	R498S	possibly damaging	Het
Glis1	A	G	4: 107,632,291	N692D	possibly damaging	Het
Gpr83	A	G	9: 14,864,871	T163A	probably benign	Het
Hmgcr	G	A	13: 96,663,068	L173F	probably damaging	Het
Htr2b	T	A	1: 86,102,455	I173F	possibly damaging	Het
Ifna11	T	C	4: 88,820,293	L112P	probably damaging	Het
Lmod1	A	G	1: 135,363,916	K170E	probably benign	Het
Lrrtm1	A	T	6: 77,243,652	M31L	probably benign	Het
Macf1	T	C	4: 123,432,902	N2815S	probably damaging	Het
Man1c1	A	G	4: 134,702,952	I173T	possibly damaging	Het
Man2b2	A	G	5: 36,820,986	I318T	probably benign	Het
Mib1	T	A	18: 10,752,033		probably benign	Het
Myo10	T	A	15: 25,795,717	S1315T	probably damaging	Het
Nsun5	C	T	5: 135,375,463	Q375*	probably null	Het
Olfr1032	T	C	2: 86,008,013	M79T	probably damaging	Het
Olfr984	A	T	9: 40,100,743	I249K	probably benign	Het
Opcml	A	G	9: 27,791,386	M1V	probably null	Het
Parm1	T	C	5: 91,594,469	I232T	possibly damaging	Het
Pdss1	T	A	2: 22,906,787		probably null	Het
Pfkfb2	G	A	1: 130,705,410	T202I	possibly damaging	Het
Postn	T	A	3: 54,370,310	F242Y	probably damaging	Het
Prss12	A	G	3: 123,486,976	T437A	probably benign	Het
Rap1gap2	C	A	11: 74,407,322	A491S	possibly damaging	Het
Rbm10	T	C	X: 20,647,695	L429P	possibly damaging	Het
Saraf	A	G	8: 34,168,581	N346D	probably benign	Het
Sec31b	T	C	19: 44,536,179	D93G	probably damaging	Het
Sgcg	A	T	14: 61,229,625	F175L	probably damaging	Het
Sh3rf2	A	G	18: 42,149,724	D449G	probably benign	Het
Slc9a3	T	C	13: 74,121,669	I52T	possibly damaging	Het
Tcf7	A	T	11: 52,282,783		probably null	Het
Tlr1	A	G	5: 64,925,908	V442A	probably damaging	Het
Tmub1	A	G	5: 24,445,924	*261Q	probably null	Het
Uck1	GCCAACACC	GCC	2: 32,256,076		probably benign	Het
Utp4	A	G	8: 106,922,929	D670G	probably damaging	Het
Vamp5	A	G	6: 72,369,340	V91A	probably benign	Het
Vmn1r35	A	T	6: 66,678,966	M73K	possibly damaging	Het
Vmn2r12	C	T	5: 109,091,531	E389K	probably damaging	Het
Wdsub1	T	C	2: 59,873,286	T112A	possibly damaging	Het
Xpo4	G	T	14: 57,604,440	Q473K	probably benign	Het
Xpo7	A	G	14: 70,671,690	I797T	probably damaging	Het
Zfp808	G	A	13: 62,171,218	V67M	probably benign	Het

Other mutations in Olfr792

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01285:Olfr792	APN	10	129540842	missense	probably benign	0.07
IGL01459:Olfr792	APN	10	129540541	start codon destroyed	probably null	1.00
IGL02090:Olfr792	APN	10	129541307	missense	probably damaging	1.00
IGL03338:Olfr792	APN	10	129541056	missense	probably damaging	0.99
R0382:Olfr792	UTSW	10	129541014	missense	probably benign	0.01
R1672:Olfr792	UTSW	10	129540692	missense	probably benign	0.00
R2285:Olfr792	UTSW	10	129540668	missense	probably benign	0.22
R3498:Olfr792	UTSW	10	129540909	missense	probably damaging	1.00
R5309:Olfr792	UTSW	10	129541265	missense	probably benign	0.01
R5312:Olfr792	UTSW	10	129541265	missense	probably benign	0.01
R6004:Olfr792	UTSW	10	129540890	missense	probably benign	0.31
R6800:Olfr792	UTSW	10	129541263	missense	probably damaging	1.00
R7127:Olfr792	UTSW	10	129541067	missense	probably damaging	1.00
R7167:Olfr792	UTSW	10	129540738	missense	possibly damaging	0.88
R7763:Olfr792	UTSW	10	129541455	missense	probably benign
R7819:Olfr792	UTSW	10	129540693	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGCAGTCACCAGATGTGTAATTG -3'
(R):5'- AATGCTCACAAGGAACCGAG -3'

Sequencing Primer
(F):5'- CAGTCACCAGATGTGTAATTGTTTTG -3'
(R):5'- TGCTCACAAGGAACCGAGGAATG -3'

Posted On

2014-12-29