Incidental Mutation 'R2938:Olfr792'
ID256117
Institutional Source Beutler Lab
Gene Symbol Olfr792
Ensembl Gene ENSMUSG00000094496
Gene Nameolfactory receptor 792
SynonymsGA_x6K02T2PULF-11219415-11220350, MOR108-2
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129539162-129542534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129540615 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 26 (F26Y)
Ref Sequence ENSEMBL: ENSMUSP00000149872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076575] [ENSMUST00000215436]
Predicted Effect probably damaging
Transcript: ENSMUST00000076575
AA Change: F26Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096707
Gene: ENSMUSG00000094496
AA Change: F26Y

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 4.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215436
AA Change: F26Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,894,733 I1775K probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdc6 A G 11: 98,910,760 I217V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Cstl1 T A 2: 148,751,057 I44N possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Postn T A 3: 54,370,310 F242Y probably damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Olfr792
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfr792 APN 10 129540842 missense probably benign 0.07
IGL01459:Olfr792 APN 10 129540541 start codon destroyed probably null 1.00
IGL02090:Olfr792 APN 10 129541307 missense probably damaging 1.00
IGL03338:Olfr792 APN 10 129541056 missense probably damaging 0.99
R0382:Olfr792 UTSW 10 129541014 missense probably benign 0.01
R1672:Olfr792 UTSW 10 129540692 missense probably benign 0.00
R2285:Olfr792 UTSW 10 129540668 missense probably benign 0.22
R3498:Olfr792 UTSW 10 129540909 missense probably damaging 1.00
R5309:Olfr792 UTSW 10 129541265 missense probably benign 0.01
R5312:Olfr792 UTSW 10 129541265 missense probably benign 0.01
R6004:Olfr792 UTSW 10 129540890 missense probably benign 0.31
R6800:Olfr792 UTSW 10 129541263 missense probably damaging 1.00
R7127:Olfr792 UTSW 10 129541067 missense probably damaging 1.00
R7167:Olfr792 UTSW 10 129540738 missense possibly damaging 0.88
R7763:Olfr792 UTSW 10 129541455 missense probably benign
R7819:Olfr792 UTSW 10 129540693 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCAGTCACCAGATGTGTAATTG -3'
(R):5'- AATGCTCACAAGGAACCGAG -3'

Sequencing Primer
(F):5'- CAGTCACCAGATGTGTAATTGTTTTG -3'
(R):5'- TGCTCACAAGGAACCGAGGAATG -3'
Posted On2014-12-29