Incidental Mutation 'R2938:Rap1gap2'
ID256119
Institutional Source Beutler Lab
Gene Symbol Rap1gap2
Ensembl Gene ENSMUSG00000038807
Gene NameRAP1 GTPase activating protein 2
SynonymsGarnl4, LOC380710
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74383356-74610915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74407322 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 491 (A491S)
Ref Sequence ENSEMBL: ENSMUSP00000040180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047488] [ENSMUST00000102521]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047488
AA Change: A491S

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040180
Gene: ENSMUSG00000038807
AA Change: A491S

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 445 1.2e-64 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102521
AA Change: A431S

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099580
Gene: ENSMUSG00000038807
AA Change: A431S

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 439 4.9e-67 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123440
Meta Mutation Damage Score 0.2916 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein that activates the small guanine-nucleotide-binding protein Rap1 in platelets. The protein interacts with synaptotagmin-like protein 1 and Rab27 and regulates secretion of dense granules from platelets at sites of endothelial damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,894,733 I1775K probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdc6 A G 11: 98,910,760 I217V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Cstl1 T A 2: 148,751,057 I44N possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr792 T A 10: 129,540,615 F26Y probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Postn T A 3: 54,370,310 F242Y probably damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Rap1gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Rap1gap2 APN 11 74416259 missense probably benign 0.25
IGL00839:Rap1gap2 APN 11 74437448 missense probably damaging 1.00
IGL02301:Rap1gap2 APN 11 74407369 missense probably damaging 1.00
IGL02367:Rap1gap2 APN 11 74397355 critical splice donor site probably null
IGL02832:Rap1gap2 APN 11 74412455 splice site probably benign
IGL03067:Rap1gap2 APN 11 74393412 missense possibly damaging 0.63
IGL03341:Rap1gap2 APN 11 74435714 missense probably damaging 1.00
IGL03355:Rap1gap2 APN 11 74412344 missense probably damaging 1.00
P0026:Rap1gap2 UTSW 11 74567210 splice site probably benign
R0106:Rap1gap2 UTSW 11 74435744 missense probably benign 0.10
R0106:Rap1gap2 UTSW 11 74435744 missense probably benign 0.10
R0514:Rap1gap2 UTSW 11 74388854 missense possibly damaging 0.74
R0518:Rap1gap2 UTSW 11 74441766 missense probably damaging 1.00
R0521:Rap1gap2 UTSW 11 74441766 missense probably damaging 1.00
R1070:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1998:Rap1gap2 UTSW 11 74395833 missense probably benign 0.04
R2144:Rap1gap2 UTSW 11 74425976 missense probably damaging 1.00
R2145:Rap1gap2 UTSW 11 74425976 missense probably damaging 1.00
R2180:Rap1gap2 UTSW 11 74393146 missense probably benign 0.24
R2991:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2992:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2993:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3033:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3035:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3686:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4426:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4427:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4621:Rap1gap2 UTSW 11 74435699 critical splice donor site probably null
R4705:Rap1gap2 UTSW 11 74437439 missense probably damaging 1.00
R4809:Rap1gap2 UTSW 11 74407974 splice site probably benign
R5092:Rap1gap2 UTSW 11 74438295 missense probably damaging 1.00
R5283:Rap1gap2 UTSW 11 74395825 missense probably damaging 1.00
R5343:Rap1gap2 UTSW 11 74441785 missense probably damaging 0.99
R5941:Rap1gap2 UTSW 11 74392237 missense probably damaging 1.00
R6414:Rap1gap2 UTSW 11 74405790 missense probably damaging 1.00
R6647:Rap1gap2 UTSW 11 74407928 missense probably benign 0.04
R6951:Rap1gap2 UTSW 11 74484948 missense possibly damaging 0.81
R7096:Rap1gap2 UTSW 11 74392231 missense probably damaging 0.99
R7107:Rap1gap2 UTSW 11 74393119 missense probably damaging 1.00
R7397:Rap1gap2 UTSW 11 74414411 missense probably benign 0.28
R7553:Rap1gap2 UTSW 11 74435722 missense probably damaging 0.97
R8038:Rap1gap2 UTSW 11 74392283 missense probably benign 0.00
R8051:Rap1gap2 UTSW 11 74395825 missense probably damaging 0.97
Z1176:Rap1gap2 UTSW 11 74610877 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGTAACAGAGCAAGACCTG -3'
(R):5'- TTGGCTGGAAATGACCGGATATG -3'

Sequencing Primer
(F):5'- GAGCAAGACCTGGACATACTACATG -3'
(R):5'- CCGGATATGAGAGGGCTAACGC -3'
Posted On2014-12-29