Incidental Mutation 'R2938:Cdc6'
ID256120
Institutional Source Beutler Lab
Gene Symbol Cdc6
Ensembl Gene ENSMUSG00000017499
Gene Namecell division cycle 6
SynonymsCDC18(S.pombe), CDC18L, cell division cycle 18 homolog (S.pombe)-like
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98907801-98923940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98910760 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 217 (I217V)
Ref Sequence ENSEMBL: ENSMUSP00000118421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092706] [ENSMUST00000093937] [ENSMUST00000133779]
Predicted Effect probably benign
Transcript: ENSMUST00000092706
AA Change: I217V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000090382
Gene: ENSMUSG00000017499
AA Change: I217V

DomainStartEndE-ValueType
PDB:2CCI|I 74 101 3e-6 PDB
AAA 196 349 2.75e-5 SMART
Cdc6_C 467 547 7.14e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093937
AA Change: I244V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091469
Gene: ENSMUSG00000017499
AA Change: I244V

DomainStartEndE-ValueType
PDB:2CCI|I 102 128 1e-5 PDB
AAA 223 376 2.75e-5 SMART
Cdc6_C 494 574 7.14e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133779
AA Change: I217V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118421
Gene: ENSMUSG00000017499
AA Change: I217V

DomainStartEndE-ValueType
PDB:2CCI|I 74 101 2e-6 PDB
AAA 196 348 4.17e-5 SMART
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Cdc6, a protein essential for the initiation of DNA replication. This protein functions as a regulator at the early steps of DNA replication. It localizes in cell nucleus during cell cyle G1, but translocates to the cytoplasm at the start of S phase. The subcellular translocation of this protein during cell cyle is regulated through its phosphorylation by Cdks. Transcription of this protein was reported to be regulated in response to mitogenic signals through transcriptional control mechanism involving E2F proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,894,733 I1775K probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Cstl1 T A 2: 148,751,057 I44N possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr792 T A 10: 129,540,615 F26Y probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Postn T A 3: 54,370,310 F242Y probably damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Cdc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cdc6 APN 11 98908771 missense probably benign 0.07
IGL01611:Cdc6 APN 11 98915163 missense probably benign 0.00
IGL02202:Cdc6 APN 11 98920815 critical splice donor site probably null
IGL03090:Cdc6 APN 11 98919296 nonsense probably null
R1482:Cdc6 UTSW 11 98916981 missense possibly damaging 0.50
R1559:Cdc6 UTSW 11 98912211 missense probably damaging 1.00
R1768:Cdc6 UTSW 11 98912217 missense probably damaging 1.00
R2044:Cdc6 UTSW 11 98910461 missense probably benign 0.23
R2183:Cdc6 UTSW 11 98908698 nonsense probably null
R2356:Cdc6 UTSW 11 98919292 missense probably benign
R4723:Cdc6 UTSW 11 98908831 critical splice donor site probably null
R5279:Cdc6 UTSW 11 98912262 missense probably damaging 1.00
R5943:Cdc6 UTSW 11 98920763 missense probably damaging 0.99
R6514:Cdc6 UTSW 11 98919292 missense probably benign
R7088:Cdc6 UTSW 11 98919239 missense probably damaging 1.00
R7387:Cdc6 UTSW 11 98908216 intron probably benign
R7662:Cdc6 UTSW 11 98910612 missense possibly damaging 0.49
R7662:Cdc6 UTSW 11 98917010 missense probably benign 0.02
R7677:Cdc6 UTSW 11 98919365 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTATCAGCAAGCCAAGCTC -3'
(R):5'- TCTAGGAAGCAGTCAATCTCCC -3'

Sequencing Primer
(F):5'- AGCTCGTCCTGAATACAGCTG -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On2014-12-29