Mutagenetix > Incidental Mutations

Incidental Mutation 'R2938:Slc9a3'

256122

Institutional Source

Beutler Lab

Gene Symbol

Slc9a3

Ensembl Gene

ENSMUSG00000036123

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 3

Synonyms

9030624O13Rik, NHE-3, NHE3

MMRRC Submission

040515-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2938 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74121457-74169442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74121669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 52 (I52T)

Ref Sequence

ENSEMBL: ENSMUSP00000153255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]

AlphaFold

G3X939

Predicted Effect

probably benign
Transcript: ENSMUST00000036208
AA Change: I52T

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: I52T

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_H_Exchanger	53	457	3.6e-87	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221410

Predicted Effect

probably benign
Transcript: ENSMUST00000221703
AA Change: I52T

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225423
AA Change: I52T

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arfgef2	T	A	2: 166,894,733	I1775K	probably damaging	Het
Arhgap45	T	A	10: 80,029,002	M933K	probably damaging	Het
Astn2	A	T	4: 65,992,313	H427Q	possibly damaging	Het
Bace2	T	C	16: 97,412,188		probably null	Het
Cacna1b	A	G	2: 24,606,528	V125A	probably benign	Het
Cbarp	T	C	10: 80,131,769	D539G	probably damaging	Het
Ccdc59	A	T	10: 105,841,527	K9M	possibly damaging	Het
Ccdc73	T	A	2: 104,975,635	L296*	probably null	Het
Cd40	G	C	2: 165,069,702	V191L	probably benign	Het
Cdc6	A	G	11: 98,910,760	I217V	probably benign	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cdr1	T	G	X: 61,185,362	D66A	unknown	Het
Cela3b	A	G	4: 137,423,263	I208T	probably benign	Het
Col1a2	A	T	6: 4,520,788	Q375L	possibly damaging	Het
Csn1s1	A	T	5: 87,677,136	Q221L	possibly damaging	Het
Cstl1	T	A	2: 148,751,057	I44N	possibly damaging	Het
Depdc5	G	A	5: 32,901,621		probably null	Het
Dthd1	A	G	5: 62,842,957	I541V	probably benign	Het
Eml6	G	A	11: 29,833,049		probably benign	Het
Fkbp15	T	A	4: 62,304,663	T1000S	probably benign	Het
Gimap8	A	T	6: 48,658,796	R498S	possibly damaging	Het
Glis1	A	G	4: 107,632,291	N692D	possibly damaging	Het
Gpr83	A	G	9: 14,864,871	T163A	probably benign	Het
Hmgcr	G	A	13: 96,663,068	L173F	probably damaging	Het
Htr2b	T	A	1: 86,102,455	I173F	possibly damaging	Het
Ifna11	T	C	4: 88,820,293	L112P	probably damaging	Het
Lmod1	A	G	1: 135,363,916	K170E	probably benign	Het
Lrrtm1	A	T	6: 77,243,652	M31L	probably benign	Het
Macf1	T	C	4: 123,432,902	N2815S	probably damaging	Het
Man1c1	A	G	4: 134,702,952	I173T	possibly damaging	Het
Man2b2	A	G	5: 36,820,986	I318T	probably benign	Het
Mib1	T	A	18: 10,752,033		probably benign	Het
Myo10	T	A	15: 25,795,717	S1315T	probably damaging	Het
Nsun5	C	T	5: 135,375,463	Q375*	probably null	Het
Olfr1032	T	C	2: 86,008,013	M79T	probably damaging	Het
Olfr792	T	A	10: 129,540,615	F26Y	probably damaging	Het
Olfr984	A	T	9: 40,100,743	I249K	probably benign	Het
Opcml	A	G	9: 27,791,386	M1V	probably null	Het
Parm1	T	C	5: 91,594,469	I232T	possibly damaging	Het
Pdss1	T	A	2: 22,906,787		probably null	Het
Pfkfb2	G	A	1: 130,705,410	T202I	possibly damaging	Het
Postn	T	A	3: 54,370,310	F242Y	probably damaging	Het
Prss12	A	G	3: 123,486,976	T437A	probably benign	Het
Rap1gap2	C	A	11: 74,407,322	A491S	possibly damaging	Het
Rbm10	T	C	X: 20,647,695	L429P	possibly damaging	Het
Saraf	A	G	8: 34,168,581	N346D	probably benign	Het
Sec31b	T	C	19: 44,536,179	D93G	probably damaging	Het
Sgcg	A	T	14: 61,229,625	F175L	probably damaging	Het
Sh3rf2	A	G	18: 42,149,724	D449G	probably benign	Het
Tcf7	A	T	11: 52,282,783		probably null	Het
Tlr1	A	G	5: 64,925,908	V442A	probably damaging	Het
Tmub1	A	G	5: 24,445,924	*261Q	probably null	Het
Uck1	GCCAACACC	GCC	2: 32,256,076		probably benign	Het
Utp4	A	G	8: 106,922,929	D670G	probably damaging	Het
Vamp5	A	G	6: 72,369,340	V91A	probably benign	Het
Vmn1r35	A	T	6: 66,678,966	M73K	possibly damaging	Het
Vmn2r12	C	T	5: 109,091,531	E389K	probably damaging	Het
Wdsub1	T	C	2: 59,873,286	T112A	possibly damaging	Het
Xpo4	G	T	14: 57,604,440	Q473K	probably benign	Het
Xpo7	A	G	14: 70,671,690	I797T	probably damaging	Het
Zfp808	G	A	13: 62,171,218	V67M	probably benign	Het

Other mutations in Slc9a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Slc9a3	APN	13	74160302	missense	probably benign	0.19
IGL01299:Slc9a3	APN	13	74160263	missense	probably benign	0.33
IGL01390:Slc9a3	APN	13	74150761	missense	probably benign	0.01
IGL01814:Slc9a3	APN	13	74165972	missense	probably damaging	0.96
IGL02020:Slc9a3	APN	13	74158848	missense	probably damaging	0.99
IGL02072:Slc9a3	APN	13	74165859	missense	probably benign	0.00
IGL02186:Slc9a3	APN	13	74163114	missense	possibly damaging	0.94
IGL02878:Slc9a3	APN	13	74165357	nonsense	probably null
IGL03056:Slc9a3	APN	13	74150819	missense	probably damaging	1.00
R0090:Slc9a3	UTSW	13	74158728	missense	probably damaging	0.99
R0280:Slc9a3	UTSW	13	74159424	missense	probably damaging	1.00
R0359:Slc9a3	UTSW	13	74157607	missense	probably damaging	1.00
R0388:Slc9a3	UTSW	13	74121536	missense	unknown
R0396:Slc9a3	UTSW	13	74157784	critical splice donor site	probably null
R0893:Slc9a3	UTSW	13	74159246	missense	probably damaging	1.00
R1169:Slc9a3	UTSW	13	74150743	missense	probably damaging	0.98
R1640:Slc9a3	UTSW	13	74158818	missense	probably damaging	1.00
R1769:Slc9a3	UTSW	13	74163071	missense	probably benign	0.00
R1850:Slc9a3	UTSW	13	74161770	missense	probably benign	0.34
R1937:Slc9a3	UTSW	13	74166056	splice site	probably null
R2048:Slc9a3	UTSW	13	74163741	missense	probably damaging	1.00
R2146:Slc9a3	UTSW	13	74121603	missense	probably benign	0.00
R2495:Slc9a3	UTSW	13	74158703	missense	probably damaging	0.99
R2883:Slc9a3	UTSW	13	74158760	missense	probably damaging	1.00
R4538:Slc9a3	UTSW	13	74161732	missense	possibly damaging	0.56
R4580:Slc9a3	UTSW	13	74158886	nonsense	probably null
R4581:Slc9a3	UTSW	13	74164165	missense	probably damaging	0.99
R4841:Slc9a3	UTSW	13	74165837	missense	probably damaging	1.00
R4928:Slc9a3	UTSW	13	74157719	missense	probably damaging	1.00
R4965:Slc9a3	UTSW	13	74164293	missense	possibly damaging	0.62
R5079:Slc9a3	UTSW	13	74164287	missense	probably damaging	0.97
R5329:Slc9a3	UTSW	13	74150960	missense	possibly damaging	0.94
R5663:Slc9a3	UTSW	13	74163712	missense	probably damaging	0.98
R5876:Slc9a3	UTSW	13	74161723	missense	probably damaging	1.00
R5919:Slc9a3	UTSW	13	74158740	missense	probably damaging	0.98
R6060:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R6562:Slc9a3	UTSW	13	74155161	missense	probably damaging	1.00
R6645:Slc9a3	UTSW	13	74164172	missense	probably damaging	0.99
R7145:Slc9a3	UTSW	13	74150678	missense	probably damaging	0.99
R7422:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R7565:Slc9a3	UTSW	13	74157694	missense	probably damaging	1.00
R7679:Slc9a3	UTSW	13	74160276	missense	possibly damaging	0.88
R8032:Slc9a3	UTSW	13	74157644	missense	probably damaging	1.00
R8080:Slc9a3	UTSW	13	74166027	missense	probably benign	0.30
R8158:Slc9a3	UTSW	13	74155122	missense	probably damaging	1.00
R8159:Slc9a3	UTSW	13	74164288	missense	probably benign	0.01
R8837:Slc9a3	UTSW	13	74157704	missense	probably damaging	1.00
R8939:Slc9a3	UTSW	13	74163776	missense	possibly damaging	0.93
R9111:Slc9a3	UTSW	13	74150801	missense	probably damaging	1.00
Z1176:Slc9a3	UTSW	13	74165856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTACTCACCAAGGTATGCGTG -3'
(R):5'- TTCTCAGACTAACAGTGCACC -3'

Sequencing Primer
(F):5'- CACCAAGGTATGCGTGTTGGC -3'
(R):5'- AACAGTGCACCGTGCTCTTG -3'

Posted On

2014-12-29