Mutagenetix > Incidental Mutation

Incidental Mutation 'R2938:Xpo4'

256124

Institutional Source

Beutler Lab

Gene Symbol

Xpo4

Ensembl Gene

ENSMUSG00000021952

Gene Name

exportin 4

Synonyms

MMRRC Submission

040515-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.841) question?

Stock #

R2938 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57577521-57665430 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 57604440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 473 (Q473K)

Ref Sequence

ENSEMBL: ENSMUSP00000086909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174152] [ENSMUST00000174545]

AlphaFold

Q9ESJ0

Predicted Effect

probably benign
Transcript: ENSMUST00000089482
AA Change: Q473K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: Q473K

Domain	Start	End	E-Value	Type
Blast:IBN_N	37	103	8e-19	BLAST
low complexity region	165	174	N/A	INTRINSIC
low complexity region	459	468	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
Pfam:CRM1_C	954	1144	6.3e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174152

Predicted Effect

probably benign
Transcript: ENSMUST00000174545
AA Change: Q473K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: Q473K

Domain	Start	End	E-Value	Type
Blast:IBN_N	37	103	8e-19	BLAST
low complexity region	165	174	N/A	INTRINSIC
low complexity region	459	468	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
Pfam:CRM1_C	952	1143	5.2e-9	PFAM

Meta Mutation Damage Score

0.0716

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arfgef2	T	A	2: 166,894,733	I1775K	probably damaging	Het
Arhgap45	T	A	10: 80,029,002	M933K	probably damaging	Het
Astn2	A	T	4: 65,992,313	H427Q	possibly damaging	Het
Bace2	T	C	16: 97,412,188		probably null	Het
Cacna1b	A	G	2: 24,606,528	V125A	probably benign	Het
Cbarp	T	C	10: 80,131,769	D539G	probably damaging	Het
Ccdc59	A	T	10: 105,841,527	K9M	possibly damaging	Het
Ccdc73	T	A	2: 104,975,635	L296*	probably null	Het
Cd40	G	C	2: 165,069,702	V191L	probably benign	Het
Cdc6	A	G	11: 98,910,760	I217V	probably benign	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cdr1	T	G	X: 61,185,362	D66A	unknown	Het
Cela3b	A	G	4: 137,423,263	I208T	probably benign	Het
Col1a2	A	T	6: 4,520,788	Q375L	possibly damaging	Het
Csn1s1	A	T	5: 87,677,136	Q221L	possibly damaging	Het
Cstl1	T	A	2: 148,751,057	I44N	possibly damaging	Het
Depdc5	G	A	5: 32,901,621		probably null	Het
Dthd1	A	G	5: 62,842,957	I541V	probably benign	Het
Eml6	G	A	11: 29,833,049		probably benign	Het
Fkbp15	T	A	4: 62,304,663	T1000S	probably benign	Het
Gimap8	A	T	6: 48,658,796	R498S	possibly damaging	Het
Glis1	A	G	4: 107,632,291	N692D	possibly damaging	Het
Gpr83	A	G	9: 14,864,871	T163A	probably benign	Het
Hmgcr	G	A	13: 96,663,068	L173F	probably damaging	Het
Htr2b	T	A	1: 86,102,455	I173F	possibly damaging	Het
Ifna11	T	C	4: 88,820,293	L112P	probably damaging	Het
Lmod1	A	G	1: 135,363,916	K170E	probably benign	Het
Lrrtm1	A	T	6: 77,243,652	M31L	probably benign	Het
Macf1	T	C	4: 123,432,902	N2815S	probably damaging	Het
Man1c1	A	G	4: 134,702,952	I173T	possibly damaging	Het
Man2b2	A	G	5: 36,820,986	I318T	probably benign	Het
Mib1	T	A	18: 10,752,033		probably benign	Het
Myo10	T	A	15: 25,795,717	S1315T	probably damaging	Het
Nsun5	C	T	5: 135,375,463	Q375*	probably null	Het
Olfr1032	T	C	2: 86,008,013	M79T	probably damaging	Het
Olfr792	T	A	10: 129,540,615	F26Y	probably damaging	Het
Olfr984	A	T	9: 40,100,743	I249K	probably benign	Het
Opcml	A	G	9: 27,791,386	M1V	probably null	Het
Parm1	T	C	5: 91,594,469	I232T	possibly damaging	Het
Pdss1	T	A	2: 22,906,787		probably null	Het
Pfkfb2	G	A	1: 130,705,410	T202I	possibly damaging	Het
Postn	T	A	3: 54,370,310	F242Y	probably damaging	Het
Prss12	A	G	3: 123,486,976	T437A	probably benign	Het
Rap1gap2	C	A	11: 74,407,322	A491S	possibly damaging	Het
Rbm10	T	C	X: 20,647,695	L429P	possibly damaging	Het
Saraf	A	G	8: 34,168,581	N346D	probably benign	Het
Sec31b	T	C	19: 44,536,179	D93G	probably damaging	Het
Sgcg	A	T	14: 61,229,625	F175L	probably damaging	Het
Sh3rf2	A	G	18: 42,149,724	D449G	probably benign	Het
Slc9a3	T	C	13: 74,121,669	I52T	possibly damaging	Het
Tcf7	A	T	11: 52,282,783		probably null	Het
Tlr1	A	G	5: 64,925,908	V442A	probably damaging	Het
Tmub1	A	G	5: 24,445,924	*261Q	probably null	Het
Uck1	GCCAACACC	GCC	2: 32,256,076		probably benign	Het
Utp4	A	G	8: 106,922,929	D670G	probably damaging	Het
Vamp5	A	G	6: 72,369,340	V91A	probably benign	Het
Vmn1r35	A	T	6: 66,678,966	M73K	possibly damaging	Het
Vmn2r12	C	T	5: 109,091,531	E389K	probably damaging	Het
Wdsub1	T	C	2: 59,873,286	T112A	possibly damaging	Het
Xpo7	A	G	14: 70,671,690	I797T	probably damaging	Het
Zfp808	G	A	13: 62,171,218	V67M	probably benign	Het

Other mutations in Xpo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01944:Xpo4	APN	14	57604398	missense	probably benign
IGL02537:Xpo4	APN	14	57593833	missense	probably benign
IGL02554:Xpo4	APN	14	57590088	missense	probably benign	0.00
IGL02826:Xpo4	APN	14	57629420	missense	possibly damaging	0.50
IGL03071:Xpo4	APN	14	57618228	missense	possibly damaging	0.66
PIT4131001:Xpo4	UTSW	14	57584611	missense	probably null	0.98
R0245:Xpo4	UTSW	14	57630240	missense	probably damaging	1.00
R0546:Xpo4	UTSW	14	57613274	missense	probably benign	0.07
R0606:Xpo4	UTSW	14	57638208	unclassified	probably benign
R0761:Xpo4	UTSW	14	57613383	missense	probably damaging	0.99
R1775:Xpo4	UTSW	14	57603672	missense	probably benign
R1853:Xpo4	UTSW	14	57585907	missense	possibly damaging	0.72
R1923:Xpo4	UTSW	14	57590871	missense	probably damaging	0.98
R2007:Xpo4	UTSW	14	57586644	missense	probably null	0.19
R2035:Xpo4	UTSW	14	57585926	missense	possibly damaging	0.57
R2174:Xpo4	UTSW	14	57590090	missense	probably damaging	1.00
R2421:Xpo4	UTSW	14	57629503	missense	probably benign	0.00
R2937:Xpo4	UTSW	14	57604440	missense	probably benign	0.03
R4066:Xpo4	UTSW	14	57588054	missense	probably benign	0.07
R4086:Xpo4	UTSW	14	57643033	intron	probably benign
R4373:Xpo4	UTSW	14	57591022	nonsense	probably null
R4620:Xpo4	UTSW	14	57630325	missense	probably damaging	1.00
R4703:Xpo4	UTSW	14	57590108	missense	probably benign	0.01
R4755:Xpo4	UTSW	14	57618181	missense	probably benign	0.01
R4831:Xpo4	UTSW	14	57590102	missense	probably damaging	1.00
R4905:Xpo4	UTSW	14	57638289	missense	possibly damaging	0.70
R4943:Xpo4	UTSW	14	57638240	missense	possibly damaging	0.68
R5074:Xpo4	UTSW	14	57584641	missense	probably benign	0.02
R5279:Xpo4	UTSW	14	57613409	missense	probably benign	0.37
R5375:Xpo4	UTSW	14	57638307	missense	probably damaging	0.99
R5690:Xpo4	UTSW	14	57590989	missense	probably benign	0.03
R5936:Xpo4	UTSW	14	57643499	missense	probably benign
R6393:Xpo4	UTSW	14	57638313	missense	probably damaging	1.00
R6824:Xpo4	UTSW	14	57613403	missense	probably damaging	1.00
R6893:Xpo4	UTSW	14	57582310	missense	probably benign
R6923:Xpo4	UTSW	14	57603711	missense	probably benign	0.19
R7028:Xpo4	UTSW	14	57597051	missense	probably benign	0.22
R7442:Xpo4	UTSW	14	57630223	missense	probably benign	0.00
R7469:Xpo4	UTSW	14	57597979	missense	probably benign
R7490:Xpo4	UTSW	14	57602621	frame shift	probably null
R7622:Xpo4	UTSW	14	57597011	missense	possibly damaging	0.94
R7667:Xpo4	UTSW	14	57589959	missense	probably damaging	0.97
R7789:Xpo4	UTSW	14	57613349	missense	probably benign	0.00
R7895:Xpo4	UTSW	14	57602591	missense	probably benign	0.03
R8000:Xpo4	UTSW	14	57589946	missense	probably damaging	1.00
R8372:Xpo4	UTSW	14	57597884	critical splice donor site	probably null
R8395:Xpo4	UTSW	14	57648467	missense	probably benign	0.01
R8420:Xpo4	UTSW	14	57604456	missense	probably damaging	0.99
R8836:Xpo4	UTSW	14	57664910	missense	probably benign	0.03
R8841:Xpo4	UTSW	14	57597956	missense	probably damaging	0.97
R8989:Xpo4	UTSW	14	57591018	missense	probably benign	0.00
R9229:Xpo4	UTSW	14	57613699	missense	probably benign
R9374:Xpo4	UTSW	14	57591055	missense	possibly damaging	0.94
R9551:Xpo4	UTSW	14	57591055	missense	possibly damaging	0.94
R9628:Xpo4	UTSW	14	57605173	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTGGGCTCCAATTGTATAAG -3'
(R):5'- TGTCCAGCTCTTCCTGAAGC -3'

Sequencing Primer
(F):5'- CTGGGCTCCAATTGTATAAGCCAAAG -3'
(R):5'- TTCCTGAAGCCACTTGACAGG -3'

Posted On

2014-12-29