Mutagenetix > Incidental Mutation

Incidental Mutation 'R0322:Tubgcp5'

25613

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp5

Ensembl Gene

ENSMUSG00000033790

Gene Name

tubulin, gamma complex associated protein 5

Synonyms

B130010C12Rik, GCP5

MMRRC Submission

038532-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R0322 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55794154-55831677 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 55814978 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 536 (G536S)

Ref Sequence

ENSEMBL: ENSMUSP00000146111 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191]

AlphaFold

Q8BKN5

Predicted Effect

probably damaging
Transcript: ENSMUST00000032627
AA Change: G536S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: G536S

Domain	Start	End	E-Value	Type
low complexity region	109	124	N/A	INTRINSIC
Pfam:Spc97_Spc98	273	942	1.2e-126	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205779

Predicted Effect

probably damaging
Transcript: ENSMUST00000205796
AA Change: G536S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000206191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206789

Meta Mutation Damage Score

0.5187

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.8%
20x: 84.3%

Validation Efficiency

98% (58/59)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,025,372	S275T	possibly damaging	Het
Adam34	G	T	8: 43,651,921	T229N	probably benign	Het
Adgrb3	C	A	1: 25,221,748		probably benign	Het
Ankhd1	T	A	18: 36,658,008	Y2478*	probably null	Het
Arl9	A	G	5: 77,007,190		probably benign	Het
Bub1b	G	A	2: 118,639,618		probably benign	Het
Chl1	A	T	6: 103,701,883		probably benign	Het
Cobl	T	A	11: 12,267,072	E465V	probably damaging	Het
Cobll1	A	T	2: 65,102,098	M520K	possibly damaging	Het
Dll3	A	G	7: 28,296,368	V336A	possibly damaging	Het
Dnmbp	T	C	19: 43,854,846	H1193R	probably damaging	Het
Fbxo43	T	C	15: 36,152,192		probably benign	Het
Gart	G	A	16: 91,623,037		probably benign	Het
Gjc3	A	T	5: 137,957,498	M175K	possibly damaging	Het
Gm9008	T	C	6: 76,496,418	Y405C	probably benign	Het
Gpc5	T	A	14: 115,399,151	N415K	probably benign	Het
Idh2	C	T	7: 80,098,257	A232T	probably damaging	Het
Il7r	A	T	15: 9,510,215	F251I	probably benign	Het
Insc	A	G	7: 114,792,265	E141G	probably damaging	Het
Itm2c	C	T	1: 85,907,030	T160M	probably damaging	Het
Mboat1	T	C	13: 30,232,080		probably benign	Het
Mdm2	G	T	10: 117,702,204	H96Q	possibly damaging	Het
Mettl13	A	G	1: 162,544,176		probably benign	Het
Mfsd4b3	T	C	10: 39,947,530	N245D	probably damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mtmr3	T	C	11: 4,487,505	Y982C	possibly damaging	Het
Mymk	A	T	2: 27,067,406	L66Q	probably damaging	Het
Myo18a	T	C	11: 77,829,800	S767P	probably damaging	Het
Ndufa8	T	C	2: 36,036,622	D134G	probably benign	Het
Noxa1	A	G	2: 25,092,554	F83S	probably damaging	Het
Npc1l1	T	A	11: 6,229,042	I123L	probably benign	Het
Ogdhl	A	G	14: 32,337,577	T394A	probably benign	Het
Olfr1193	T	C	2: 88,678,667	S264P	probably damaging	Het
Olfr290	A	G	7: 84,916,313	Y178C	probably damaging	Het
Pcdh20	T	C	14: 88,468,947	T306A	probably benign	Het
Pcid2	G	A	8: 13,090,775		probably benign	Het
Phyhip	G	A	14: 70,463,396	V108M	possibly damaging	Het
Pnpla5	G	T	15: 84,120,719	L144M	probably damaging	Het
Psmb4	A	G	3: 94,886,091	Y160H	probably benign	Het
Riox2	A	T	16: 59,489,389	K369*	probably null	Het
Sh3tc1	G	A	5: 35,706,561	P761S	possibly damaging	Het
Slc6a3	T	A	13: 73,560,926	V323D	possibly damaging	Het
Smg7	A	G	1: 152,849,873		probably null	Het
Srrt	G	A	5: 137,296,608	R370C	probably damaging	Het
Stc1	T	C	14: 69,029,409	V7A	probably benign	Het
Svep1	G	T	4: 58,057,996		probably benign	Het
Tbpl2	A	G	2: 24,094,979	V51A	probably benign	Het
Tecr	A	G	8: 83,572,243	Y248H	probably damaging	Het
Tenm3	A	G	8: 48,236,912		probably benign	Het
Tia1	C	T	6: 86,420,387	A114V	probably damaging	Het
Tmprss11f	A	T	5: 86,591,416	M2K	probably benign	Het
Tnfsf8	T	C	4: 63,834,166	T221A	probably damaging	Het
Tyr	A	T	7: 87,492,917	I145N	probably benign	Het
Ubr4	T	A	4: 139,422,418	V1809E	probably damaging	Het
Vmn2r65	A	T	7: 84,946,548	N309K	probably benign	Het

Other mutations in Tubgcp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Tubgcp5	APN	7	55806595	missense	possibly damaging	0.91
IGL01291:Tubgcp5	APN	7	55808529	missense	possibly damaging	0.83
IGL01343:Tubgcp5	APN	7	55796031	splice site	probably benign
IGL01597:Tubgcp5	APN	7	55806832	splice site	probably benign
IGL01688:Tubgcp5	APN	7	55815018	missense	possibly damaging	0.92
IGL01843:Tubgcp5	APN	7	55799473	missense	probably benign	0.02
IGL01950:Tubgcp5	APN	7	55806088	missense	possibly damaging	0.93
IGL01957:Tubgcp5	APN	7	55818757	missense	probably damaging	1.00
IGL02902:Tubgcp5	APN	7	55806607	nonsense	probably null
IGL03105:Tubgcp5	APN	7	55825581	missense	probably damaging	1.00
ANU05:Tubgcp5	UTSW	7	55808529	missense	possibly damaging	0.83
R0078:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R0362:Tubgcp5	UTSW	7	55800684	missense	probably damaging	1.00
R0449:Tubgcp5	UTSW	7	55823567	missense	probably benign
R0488:Tubgcp5	UTSW	7	55829338	missense	probably damaging	0.96
R0853:Tubgcp5	UTSW	7	55814851	splice site	probably benign
R0885:Tubgcp5	UTSW	7	55806055	nonsense	probably null
R1483:Tubgcp5	UTSW	7	55825707	critical splice donor site	probably null
R1746:Tubgcp5	UTSW	7	55808537	missense	probably benign	0.05
R1766:Tubgcp5	UTSW	7	55815020	missense	probably benign	0.15
R2148:Tubgcp5	UTSW	7	55799511	missense	probably damaging	1.00
R2229:Tubgcp5	UTSW	7	55830881	missense	probably damaging	1.00
R3766:Tubgcp5	UTSW	7	55830866	missense	probably damaging	0.98
R4154:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R4838:Tubgcp5	UTSW	7	55794185	unclassified	probably benign
R4948:Tubgcp5	UTSW	7	55806123	missense	probably benign	0.00
R5110:Tubgcp5	UTSW	7	55808637	missense	probably damaging	0.96
R5347:Tubgcp5	UTSW	7	55823685	missense	probably damaging	1.00
R5417:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R5574:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R5758:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R5957:Tubgcp5	UTSW	7	55814962	missense	probably benign	0.03
R6014:Tubgcp5	UTSW	7	55823609	missense	probably benign
R6141:Tubgcp5	UTSW	7	55806778	missense	probably benign	0.30
R6289:Tubgcp5	UTSW	7	55795923	missense	probably benign	0.05
R6511:Tubgcp5	UTSW	7	55817392	nonsense	probably null
R6563:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R6574:Tubgcp5	UTSW	7	55823583	missense	probably benign
R6596:Tubgcp5	UTSW	7	55806634	missense	probably benign	0.38
R7016:Tubgcp5	UTSW	7	55794229	missense	possibly damaging	0.76
R7038:Tubgcp5	UTSW	7	55805366	missense	probably damaging	0.99
R7075:Tubgcp5	UTSW	7	55829407	missense	probably benign	0.04
R7083:Tubgcp5	UTSW	7	55800695	nonsense	probably null
R7213:Tubgcp5	UTSW	7	55806112	missense	probably damaging	0.97
R7284:Tubgcp5	UTSW	7	55823567	missense	probably benign
R7600:Tubgcp5	UTSW	7	55808513	missense	probably benign
R7813:Tubgcp5	UTSW	7	55800696	missense	possibly damaging	0.49
R7920:Tubgcp5	UTSW	7	55816562	missense	probably benign	0.00
R7948:Tubgcp5	UTSW	7	55794248	missense	probably benign	0.01
R8438:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R8499:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R9087:Tubgcp5	UTSW	7	55817358	missense	probably damaging	1.00
R9211:Tubgcp5	UTSW	7	55806583	missense	probably benign	0.05
R9269:Tubgcp5	UTSW	7	55795945	missense	possibly damaging	0.94
R9329:Tubgcp5	UTSW	7	55829433	critical splice donor site	probably null
R9355:Tubgcp5	UTSW	7	55817429	critical splice donor site	probably null
R9498:Tubgcp5	UTSW	7	55813485	missense	possibly damaging	0.46
R9687:Tubgcp5	UTSW	7	55825579	critical splice acceptor site	probably null
Z1088:Tubgcp5	UTSW	7	55815101	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGCTCAACCCTAATTGCTCTGGTAAA -3'
(R):5'- AGAAGAAGCAGGCTGCTACCTCT -3'

Sequencing Primer
(F):5'- cttaccctctgagctatctcac -3'
(R):5'- GCTACCTCTGGCTGCTG -3'

Posted On

2013-04-16