Incidental Mutation 'R1636:Def6'
Institutional Source Beutler Lab
Gene Symbol Def6
Ensembl Gene ENSMUSG00000002257
Gene Namedifferentially expressed in FDCP 6
SynonymsIBP, SLAT, 6430538D02Rik, IRF-4-binding protein, 2410003F05Rik
MMRRC Submission 039672-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1636 (G1)
Quality Score76
Status Validated
Chromosomal Location28207778-28228608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28223918 bp
Amino Acid Change Glutamic Acid to Glycine at position 316 (E316G)
Ref Sequence ENSEMBL: ENSMUSP00000002327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002327]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002327
AA Change: E316G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000002327
Gene: ENSMUSG00000002257
AA Change: E316G

low complexity region 145 166 N/A INTRINSIC
PH 217 314 3.87e-20 SMART
coiled coil region 318 551 N/A INTRINSIC
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants spontaneously develop systemic autoimmunity. Females primarily are affected, displaying hypergammaglobulinemia, accumulation of effector/memory T cells and IgG+ B cells, and production of autoantibodies [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Abca7 A G 10: 80,008,998 H1518R probably benign Het
Adam4 A G 12: 81,419,690 L719S probably damaging Het
Adprm T C 11: 67,041,723 Y120C possibly damaging Het
Arhgap25 T A 6: 87,495,941 Y78F probably damaging Het
Asap1 G A 15: 64,123,912 P665L probably damaging Het
Bank1 T C 3: 136,083,226 K637R probably damaging Het
BC005561 T A 5: 104,520,750 M1046K probably damaging Het
Bcr T A 10: 75,131,066 L502M probably damaging Het
Brwd1 A G 16: 96,059,641 L315P probably damaging Het
Btbd7 A T 12: 102,793,851 Y613N probably damaging Het
Cdca7l G A 12: 117,876,928 R395H probably damaging Het
Cftr T A 6: 18,226,157 I368K probably damaging Het
D6Wsu163e T C 6: 126,946,601 V150A possibly damaging Het
Ddx52 A G 11: 83,955,343 T470A probably damaging Het
Dip2a A T 10: 76,321,578 N64K probably benign Het
Dlgap4 G T 2: 156,746,077 E631* probably null Het
Dner T C 1: 84,585,330 K190E possibly damaging Het
Eif2b4 T A 5: 31,192,266 probably null Het
Eif3a A T 19: 60,781,905 D119E possibly damaging Het
Ercc2 C T 7: 19,387,124 T276M possibly damaging Het
Exoc1 A G 5: 76,568,118 K830R probably benign Het
F2r G T 13: 95,603,892 Y378* probably null Het
Fam186a G A 15: 99,941,658 T2235I unknown Het
Fmo3 T G 1: 162,954,425 K453T probably benign Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Galns A G 8: 122,604,216 probably benign Het
Gm1818 T C 12: 48,555,767 noncoding transcript Het
Gm9955 C A 18: 24,709,230 probably benign Het
Immp2l T C 12: 41,703,687 V113A probably damaging Het
Iyd T A 10: 3,545,588 M82K possibly damaging Het
Kif21a A T 15: 90,984,805 probably benign Het
Lipf A G 19: 33,976,535 D342G probably damaging Het
Lmbrd1 C A 1: 24,746,930 Y435* probably null Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mtrf1l A G 10: 5,813,265 S355P probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neo1 T C 9: 58,913,277 S788G probably damaging Het
Nfx1 T G 4: 41,016,072 probably null Het
Nlrp4c T C 7: 6,066,738 V546A possibly damaging Het
Nwd2 G A 5: 63,807,557 V1495M probably damaging Het
Oaf T A 9: 43,239,324 I84F probably benign Het
Obscn A G 11: 59,122,637 F1153S probably damaging Het
Ofcc1 A T 13: 40,180,428 C396S possibly damaging Het
Olfr576 T G 7: 102,965,691 I197S possibly damaging Het
Olfr955 T C 9: 39,469,919 D269G probably benign Het
Omg A G 11: 79,502,340 S231P probably benign Het
Pdcl3 A G 1: 38,994,935 T53A possibly damaging Het
Pik3r2 A T 8: 70,771,898 H244Q probably benign Het
Pinx1 A T 14: 63,866,137 H55L probably damaging Het
Pwwp2b T A 7: 139,254,842 H66Q probably benign Het
Rell2 A G 18: 37,958,079 D99G probably damaging Het
Reln G A 5: 21,998,683 A1191V probably damaging Het
Rprm T C 2: 54,085,304 M1V probably null Het
Sav1 A C 12: 69,984,495 H84Q probably benign Het
Scamp5 T C 9: 57,451,409 D28G possibly damaging Het
Selenbp2 G A 3: 94,696,815 G9D probably damaging Het
Sh3tc2 T C 18: 61,989,721 W518R probably damaging Het
Slc10a6 A T 5: 103,629,146 N29K probably benign Het
Spindoc C A 19: 7,374,557 D142Y probably damaging Het
Spink12 T A 18: 44,107,728 D60E probably benign Het
Sugt1 A G 14: 79,587,982 I23V probably benign Het
Syne2 T C 12: 76,004,732 C4079R probably benign Het
Tex15 T G 8: 33,576,387 Y1948* probably null Het
Tln2 T C 9: 67,306,532 E321G probably damaging Het
Tmem198b A G 10: 128,802,196 L166P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttn T A 2: 76,900,222 probably benign Het
Unc13a G A 8: 71,653,390 T690I probably damaging Het
Ush2a T C 1: 188,466,176 I1479T possibly damaging Het
Vcan G A 13: 89,703,667 T1058I possibly damaging Het
Vmn1r84 T C 7: 12,362,595 Q45R probably benign Het
Vmn2r111 T C 17: 22,571,399 N209D probably damaging Het
Wbp1l A G 19: 46,644,444 Y40C probably damaging Het
Wdr72 A T 9: 74,179,625 H625L probably benign Het
Zeb2 T C 2: 45,002,611 Y195C probably damaging Het
Zkscan6 C T 11: 65,814,430 probably benign Het
Zmym6 C A 4: 127,123,767 H1022N probably damaging Het
Other mutations in Def6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Def6 APN 17 28219740 splice site probably benign
IGL01619:Def6 APN 17 28207864 missense probably damaging 1.00
IGL01737:Def6 APN 17 28223727 missense possibly damaging 0.94
IGL02550:Def6 APN 17 28228261 missense probably benign 0.03
R0013:Def6 UTSW 17 28217092 missense probably damaging 1.00
R0335:Def6 UTSW 17 28228069 missense possibly damaging 0.83
R0357:Def6 UTSW 17 28223935 missense probably damaging 1.00
R0373:Def6 UTSW 17 28220180 missense probably damaging 0.96
R1161:Def6 UTSW 17 28217619 missense probably benign 0.00
R1310:Def6 UTSW 17 28217619 missense probably benign 0.00
R1470:Def6 UTSW 17 28225982 missense possibly damaging 0.67
R1470:Def6 UTSW 17 28225982 missense possibly damaging 0.67
R1778:Def6 UTSW 17 28220186 missense probably benign 0.02
R2432:Def6 UTSW 17 28228069 missense probably benign 0.03
R3881:Def6 UTSW 17 28220215 missense probably damaging 1.00
R4402:Def6 UTSW 17 28219976 missense probably damaging 0.99
R4589:Def6 UTSW 17 28228147 missense probably benign
R4683:Def6 UTSW 17 28217635 missense probably damaging 0.99
R5704:Def6 UTSW 17 28228226 missense probably benign
R6481:Def6 UTSW 17 28226163 missense probably benign 0.00
R6805:Def6 UTSW 17 28223717 missense probably damaging 1.00
R7029:Def6 UTSW 17 28225969 missense probably benign 0.05
R7863:Def6 UTSW 17 28227867 missense possibly damaging 0.62
R8229:Def6 UTSW 17 28217755 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ttcctctccttctcctcctg -3'
Posted On2014-12-30