Mutagenetix > Incidental Mutation

Incidental Mutation 'R1569:Rfx2'

256144

Institutional Source

Beutler Lab

Gene Symbol

Rfx2

Ensembl Gene

ENSMUSG00000024206

Gene Name

regulatory factor X, 2 (influences HLA class II expression)

Synonyms

5430432H19Rik

MMRRC Submission

039608-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.738) question?

Stock #

R1569 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

56775897-56831008 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56804326 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 82 (I82N)

Ref Sequence

ENSEMBL: ENSMUSP00000084010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]

AlphaFold

P48379

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002444
AA Change: I82N

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: I82N

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	4	149	1.9e-50	PFAM
Pfam:RFX_DNA_binding	192	269	4.3e-36	PFAM
Blast:HisKA	479	542	1e-31	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086801
AA Change: I82N

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: I82N

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	151	6.8e-56	PFAM
Pfam:RFX_DNA_binding	161	246	6e-41	PFAM
Blast:HisKA	454	517	1e-31	BLAST

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.3%

Validation Efficiency

96% (72/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,293,797	K166*	probably null	Het
Abca2	T	A	2: 25,439,185	N1012K	probably benign	Het
Ahnak	T	C	19: 9,004,094	V914A	possibly damaging	Het
Akap1	T	A	11: 88,833,180	M833L	probably benign	Het
Atp2b1	T	A	10: 98,987,326	H249Q	probably benign	Het
Atp6v0a4	A	G	6: 38,050,625	V750A	probably damaging	Het
Car6	T	C	4: 150,201,042	Y23C	probably damaging	Het
Celsr3	A	G	9: 108,829,068	T917A	probably damaging	Het
Clmn	C	A	12: 104,781,081	D736Y	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dennd4c	G	A	4: 86,786,094	R282H	possibly damaging	Het
Dsg1b	T	A	18: 20,396,480	N327K	probably damaging	Het
Eftud2	A	T	11: 102,854,771		probably benign	Het
Esyt1	G	T	10: 128,518,994	S512R	possibly damaging	Het
Fam124b	T	C	1: 80,213,135	Y177C	possibly damaging	Het
Fbxl5	A	T	5: 43,765,461	I205K	probably damaging	Het
Fcrl1	A	G	3: 87,384,705	Y57C	probably damaging	Het
Gabpb1	A	T	2: 126,652,251	D151E	probably benign	Het
Gcc2	C	T	10: 58,270,171	L310F	probably benign	Het
Hsd11b1	C	G	1: 193,240,327	E141Q	probably damaging	Het
Htr1b	A	G	9: 81,632,287	V89A	probably benign	Het
Ibsp	A	T	5: 104,310,151	T185S	probably damaging	Het
Igfn1	T	C	1: 135,969,033	D1265G	probably benign	Het
Ints9	T	C	14: 64,980,122	Y33H	possibly damaging	Het
Kif1a	A	T	1: 93,058,810		probably benign	Het
Lama1	A	T	17: 67,780,618		probably null	Het
Lbp	A	T	2: 158,319,687	D223V	probably damaging	Het
Lck	C	A	4: 129,555,656	D283Y	probably damaging	Het
Lcmt2	A	G	2: 121,139,828	F258S	probably damaging	Het
Lsg1	G	T	16: 30,581,005		probably null	Het
Maip1	T	C	1: 57,413,395		probably benign	Het
Mark3	T	G	12: 111,633,746	I465S	probably benign	Het
Marveld2	C	T	13: 100,600,998	V128I	probably benign	Het
Mcm3ap	A	G	10: 76,483,188	H750R	possibly damaging	Het
Mdn1	A	T	4: 32,723,501	Q2479L	probably null	Het
Met	A	T	6: 17,531,504	K594*	probably null	Het
Pak2	G	T	16: 32,037,295	S241R	probably damaging	Het
Plxna4	T	C	6: 32,185,475	I1368V	possibly damaging	Het
Pparg	T	C	6: 115,439,999	I51T	probably benign	Het
Ppp1r18	A	G	17: 35,868,703	E62G	probably damaging	Het
Prkag2	T	C	5: 24,947,477	S86G	possibly damaging	Het
Rabgap1l	A	T	1: 160,702,390	I347K	probably benign	Het
Rdh1	A	T	10: 127,763,072	M141L	probably benign	Het
Sh2b2	G	A	5: 136,231,735	A209V	possibly damaging	Het
Sh3d19	G	A	3: 86,126,644	R768H	possibly damaging	Het
Sh3rf1	C	T	8: 61,384,862	P814S	probably damaging	Het
Shbg	T	A	11: 69,617,589		probably benign	Het
Slc15a2	T	C	16: 36,756,383	T430A	probably benign	Het
Slc17a3	A	T	13: 23,855,608	I250F	probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spg11	A	G	2: 122,101,706	S552P	probably damaging	Het
Srpk2	A	G	5: 23,514,026	I597T	probably damaging	Het
St6galnac1	T	G	11: 116,769,271	N72T	possibly damaging	Het
Tecpr2	T	A	12: 110,944,887		probably null	Het
Tmem208	T	A	8: 105,334,830	C163S	possibly damaging	Het
Tpte	T	C	8: 22,345,031	V401A	probably damaging	Het
Trhde	A	G	10: 114,446,188	W795R	possibly damaging	Het
Trpm3	G	A	19: 22,889,445		probably null	Het
Ttn	T	A	2: 76,795,719	T14999S	possibly damaging	Het
Txndc2	A	T	17: 65,638,926	N85K	probably benign	Het
Yes1	A	G	5: 32,653,163	Y192C	probably damaging	Het
Zan	A	G	5: 137,429,130	V2415A	unknown	Het
Zfp410	T	A	12: 84,332,952	C311S	probably damaging	Het
Zfp51	A	T	17: 21,456,380	M38L	probably benign	Het
Zfp560	A	T	9: 20,348,715	C284S	possibly damaging	Het
Zfp808	C	T	13: 62,172,900	R648*	probably null	Het
Zfp976	G	T	7: 42,613,382	H344N	probably damaging	Het

Other mutations in Rfx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Rfx2	APN	17	56783657	missense	probably damaging	1.00
IGL01296:Rfx2	APN	17	56808317	start codon destroyed	possibly damaging	0.81
IGL01488:Rfx2	APN	17	56805398	missense	probably damaging	1.00
IGL01705:Rfx2	APN	17	56785303	missense	possibly damaging	0.88
IGL02389:Rfx2	APN	17	56808325	splice site	probably benign
IGL02601:Rfx2	APN	17	56785354	missense	possibly damaging	0.75
IGL02609:Rfx2	APN	17	56805404	missense	probably benign	0.00
R0066:Rfx2	UTSW	17	56786736	splice site	probably benign
R0066:Rfx2	UTSW	17	56786736	splice site	probably benign
R0197:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R0370:Rfx2	UTSW	17	56799308	missense	probably benign	0.03
R0413:Rfx2	UTSW	17	56784418	splice site	probably benign
R0622:Rfx2	UTSW	17	56777071	missense	probably damaging	0.99
R0883:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R1429:Rfx2	UTSW	17	56804369	missense	probably damaging	0.97
R1439:Rfx2	UTSW	17	56787720	missense	probably damaging	1.00
R1654:Rfx2	UTSW	17	56808263	missense	probably benign	0.00
R1751:Rfx2	UTSW	17	56784754	missense	probably benign	0.01
R1816:Rfx2	UTSW	17	56808305	nonsense	probably null
R2282:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R3408:Rfx2	UTSW	17	56803526	missense	probably benign	0.00
R3962:Rfx2	UTSW	17	56785302	missense	probably damaging	0.99
R4415:Rfx2	UTSW	17	56787733	missense	possibly damaging	0.95
R4876:Rfx2	UTSW	17	56784706	missense	probably benign	0.00
R4883:Rfx2	UTSW	17	56783747	missense	probably damaging	0.98
R5588:Rfx2	UTSW	17	56779890	missense	possibly damaging	0.69
R5766:Rfx2	UTSW	17	56803587	missense	probably benign	0.02
R5798:Rfx2	UTSW	17	56804362	missense	possibly damaging	0.89
R5931:Rfx2	UTSW	17	56780778	missense	probably damaging	0.99
R6061:Rfx2	UTSW	17	56777473	missense	possibly damaging	0.86
R6466:Rfx2	UTSW	17	56784397	missense	probably benign	0.13
R6800:Rfx2	UTSW	17	56780804	missense	probably damaging	0.99
R7329:Rfx2	UTSW	17	56803681	missense	probably benign	0.05
R7476:Rfx2	UTSW	17	56803527	missense	probably benign	0.31
R8159:Rfx2	UTSW	17	56803605	missense	probably benign	0.43
R8274:Rfx2	UTSW	17	56804348	missense	probably benign	0.00
R8838:Rfx2	UTSW	17	56780877	missense	possibly damaging	0.91
R8964:Rfx2	UTSW	17	56786696	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCAAGTTATCACTCTCAGGGGC -3'
(R):5'- GGACTCTATGCAGAGCACAGAACAC -3'

Sequencing Primer
(F):5'- ACTCTCAGGGGCCTATGACTTAG -3'
(R):5'- TCACTTCTCATTGCAGGTGC -3'

Posted On

2014-12-31