Incidental Mutation 'R1826:Pik3c2a'
ID256150
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
SynonymsPI3KC2
MMRRC Submission 039853-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1826 (G1)
Quality Score47
Status Validated
Chromosome7
Chromosomal Location116337265-116443449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116368117 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 862 (D862N)
Ref Sequence ENSEMBL: ENSMUSP00000146181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]
Predicted Effect probably benign
Transcript: ENSMUST00000170430
AA Change: D862N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: D862N

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206219
AA Change: D862N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000206385
AA Change: D25N
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 95% (116/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,822,014 S917P probably benign Het
Acsbg1 C T 9: 54,622,556 V256M possibly damaging Het
Adam34 T A 8: 43,651,342 D422V probably damaging Het
Adam6a T A 12: 113,546,122 V705E possibly damaging Het
Adamts12 C A 15: 11,071,520 P50Q probably benign Het
Arfgap3 C T 15: 83,303,102 probably null Het
Aspg T A 12: 112,123,418 D463E probably damaging Het
Atad2b G A 12: 4,974,094 S73N probably benign Het
Atp11a T C 8: 12,846,154 L788P probably damaging Het
B3gnt8 T C 7: 25,628,763 F206S probably damaging Het
Baz2b T C 2: 59,968,733 E349G probably benign Het
Bmp2k A T 5: 97,061,402 probably benign Het
Camta2 A G 11: 70,683,308 F128L probably damaging Het
Ccdc88a A T 11: 29,489,637 Q30L possibly damaging Het
Cdh1 T C 8: 106,666,266 M794T probably benign Het
Cdh5 A G 8: 104,131,091 N383S possibly damaging Het
Cep85l T C 10: 53,348,812 D227G possibly damaging Het
Clec4e A G 6: 123,283,632 S156P probably damaging Het
Col10a1 G T 10: 34,394,649 G206C probably damaging Het
Col4a2 T C 8: 11,313,509 probably null Het
Copg2 A G 6: 30,812,842 M517T probably benign Het
Cyp2f2 T A 7: 27,132,562 L414Q probably damaging Het
Dact1 G A 12: 71,318,344 G596D probably damaging Het
Dcaf13 T C 15: 39,118,899 C87R probably damaging Het
Dchs1 T G 7: 105,757,627 T2224P probably damaging Het
Dnah12 A G 14: 26,711,019 M429V probably benign Het
Dppa2 G A 16: 48,317,348 R231H probably damaging Het
Elavl4 T C 4: 110,251,292 D78G probably damaging Het
Enthd1 T C 15: 80,474,281 E346G probably damaging Het
Exoc3l A T 8: 105,293,618 I225N probably damaging Het
Fam208b T A 13: 3,581,759 N914I probably damaging Het
Fasn C T 11: 120,808,499 probably benign Het
Fbxl7 G A 15: 26,552,765 R139C possibly damaging Het
Fbxw15 C A 9: 109,559,714 probably null Het
Flnc A G 6: 29,455,185 T1971A probably damaging Het
Fnip1 T G 11: 54,466,164 V33G probably damaging Het
Foxn2 A G 17: 88,486,805 E390G possibly damaging Het
Fry C T 5: 150,436,709 S1940L possibly damaging Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Gabrd T C 4: 155,386,486 Y255C probably damaging Het
Garem1 A T 18: 21,129,452 F768L probably benign Het
Gas2 T A 7: 51,943,673 L167Q probably damaging Het
Gm16391 A G 17: 76,284,423 noncoding transcript Het
Gm1979 A T 5: 26,001,242 N113K probably damaging Het
Gm5751 T A X: 8,880,705 Y133* probably null Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Hdac4 T A 1: 91,984,699 N352Y probably damaging Het
Hdac9 A G 12: 34,429,492 probably benign Het
Hhipl2 G A 1: 183,436,344 S673N probably benign Het
Iffo2 T A 4: 139,614,065 S417T probably benign Het
Itgb5 G T 16: 33,865,560 R90L possibly damaging Het
Jade1 T G 3: 41,613,213 L572W probably damaging Het
Kcnh1 T A 1: 192,413,068 M478K possibly damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnq4 T A 4: 120,704,504 H456L probably benign Het
Kif9 C A 9: 110,517,633 T613K probably benign Het
Krt36 T G 11: 100,103,030 probably benign Het
Kyat3 A T 3: 142,723,179 D89V possibly damaging Het
Lnpep A T 17: 17,562,836 F568I probably damaging Het
Lpl T C 8: 68,902,291 F444L possibly damaging Het
Lrp1 A T 10: 127,553,707 V3153E probably damaging Het
Lrrn1 A T 6: 107,567,568 N109I probably benign Het
Ltn1 A G 16: 87,415,616 Y686H probably damaging Het
Mcoln2 A C 3: 146,175,472 D166A possibly damaging Het
Ms4a6b A T 19: 11,523,934 I103F probably damaging Het
Mtmr10 T G 7: 64,337,466 S585A probably benign Het
Mx1 T C 16: 97,455,637 N114S possibly damaging Het
Mysm1 A T 4: 94,970,686 N75K probably benign Het
Nkx1-1 A G 5: 33,433,933 V15A unknown Het
Nlrp1a T A 11: 71,107,980 probably benign Het
Nlrp1a G A 11: 71,122,747 T559I possibly damaging Het
Oas1f A G 5: 120,855,589 K288R probably benign Het
Olfr1494 T A 19: 13,749,347 D80E probably benign Het
Olfr311 T A 11: 58,841,431 C106S probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pcdhb5 C T 18: 37,321,469 R301* probably null Het
Phf12 T C 11: 78,024,954 probably benign Het
Pkhd1l1 T A 15: 44,503,345 L740I possibly damaging Het
Ppp1r9a A T 6: 5,111,060 probably benign Het
Prg4 T C 1: 150,452,009 D820G probably benign Het
Prmt9 C T 8: 77,555,674 Q67* probably null Het
Prob1 T C 18: 35,653,575 E542G possibly damaging Het
Pttg1 A G 11: 43,420,366 V188A probably damaging Het
Rassf1 T A 9: 107,558,193 L260H probably damaging Het
Rbm5 T A 9: 107,742,414 Q766L probably damaging Het
Rbms3 T A 9: 116,822,868 Y137F probably damaging Het
Rccd1 T C 7: 80,320,218 probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Setd4 T A 16: 93,591,299 K100* probably null Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Slc16a1 G T 3: 104,650,939 A91S probably benign Het
Slc36a1 A G 11: 55,220,453 N133S probably benign Het
Svil C T 18: 5,063,383 P885S probably benign Het
Svop A T 5: 114,060,056 probably null Het
Taar7d T C 10: 24,027,576 Y119H probably damaging Het
Tgfb3 T C 12: 86,062,044 T304A probably benign Het
Tmem94 C A 11: 115,793,213 C786* probably null Het
Tnfrsf4 T A 4: 156,016,279 probably null Het
Tns1 C A 1: 73,953,634 M1I probably null Het
Trappc13 C T 13: 104,169,819 probably null Het
Trim72 T C 7: 128,007,844 F182L possibly damaging Het
Ttc6 T C 12: 57,660,247 S647P probably benign Het
Tulp1 A G 17: 28,356,367 L400P possibly damaging Het
Vegfc C T 8: 54,181,312 T342M possibly damaging Het
Vit T A 17: 78,534,676 V15E probably benign Het
Vps13d A T 4: 145,155,003 M1334K probably damaging Het
Zfp280d T C 9: 72,298,780 V23A probably damaging Het
Zfp608 A G 18: 54,898,576 I764T probably benign Het
Zfp94 T C 7: 24,309,115 Y33C probably damaging Het
Zfyve26 T A 12: 79,269,049 I1218F probably damaging Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 116376283 missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 116364500 missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 116373803 missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116418194 missense probably benign 0.01
IGL01462:Pik3c2a APN 7 116376250 missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 116350765 intron probably benign
IGL01695:Pik3c2a APN 7 116417518 missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 116346188 missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 116350804 missense probably benign 0.00
IGL02160:Pik3c2a APN 7 116388064 missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 116363340 splice site probably benign
IGL02345:Pik3c2a APN 7 116405891 missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 116372814 missense probably benign 0.00
IGL02756:Pik3c2a APN 7 116364513 missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116418021 missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116417839 missense probably benign 0.21
R0046:Pik3c2a UTSW 7 116354072 missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 116373744 missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 116354055 missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 116346247 splice site probably benign
R0991:Pik3c2a UTSW 7 116362045 critical splice donor site probably null
R1074:Pik3c2a UTSW 7 116350925 nonsense probably null
R1485:Pik3c2a UTSW 7 116417673 missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 116388065 missense probably benign 0.01
R1510:Pik3c2a UTSW 7 116388045 missense probably benign 0.00
R1654:Pik3c2a UTSW 7 116368848 missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116417927 nonsense probably null
R1733:Pik3c2a UTSW 7 116418520 start codon destroyed possibly damaging 0.96
R1751:Pik3c2a UTSW 7 116346236 missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116417664 missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 116376512 critical splice donor site probably null
R1875:Pik3c2a UTSW 7 116417971 missense probably benign 0.35
R1995:Pik3c2a UTSW 7 116354006 missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 116342237 missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 116364503 missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 116350822 missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116417451 critical splice donor site probably null
R2068:Pik3c2a UTSW 7 116372891 nonsense probably null
R3814:Pik3c2a UTSW 7 116348179 missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 116364550 nonsense probably null
R4386:Pik3c2a UTSW 7 116354099 missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 116358688 missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116417825 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 116376283 missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 116348274 missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 116342401 missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 116350786 missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116417658 missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116405951 missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 116372814 missense probably benign 0.00
R5951:Pik3c2a UTSW 7 116368184 missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 116362564 missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 116348205 missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116417496 missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 116340225 critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 116368758 missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 116362184 missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 116394305 missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116417988 missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116418133 nonsense probably null
R7153:Pik3c2a UTSW 7 116342252 missense probably damaging 1.00
R7176:Pik3c2a UTSW 7 116388096 missense possibly damaging 0.47
R7265:Pik3c2a UTSW 7 116388086 missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116405943 missense probably benign 0.00
R7308:Pik3c2a UTSW 7 116373839 missense probably damaging 1.00
R7375:Pik3c2a UTSW 7 116376386 missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 116354007 missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 116372854 missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 116394239 missense probably damaging 1.00
R7539:Pik3c2a UTSW 7 116340096 missense probably damaging 0.97
R7684:Pik3c2a UTSW 7 116388077 nonsense probably null
R7737:Pik3c2a UTSW 7 116356253 missense probably damaging 0.99
R7739:Pik3c2a UTSW 7 116394294 missense probably benign 0.26
R7852:Pik3c2a UTSW 7 116417458 missense probably benign
R7935:Pik3c2a UTSW 7 116417458 missense probably benign
R8005:Pik3c2a UTSW 7 116418036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCTCTTCATATCAAGAC -3'
(R):5'- CAGTTTCTCTGAGAGTAAAACATGG -3'

Sequencing Primer
(F):5'- CCCTCTTCATATCAAGACAACTTAAC -3'
(R):5'- GTCTACAGAGTGAGTTCCAGCAC -3'
Posted On2014-12-31