Incidental Mutation 'R0322:Tyr'
ID25617
Institutional Source Beutler Lab
Gene Symbol Tyr
Ensembl Gene ENSMUSG00000004651
Gene Nametyrosinase
SynonymsOca1, skc35
MMRRC Submission 038532-MU
Accession Numbers

Ncbi RefSeq: NM_011661.4; MGI:98880

Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0322 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location87424771-87493512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87492917 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 145 (I145N)
Ref Sequence ENSEMBL: ENSMUSP00000004770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004770] [ENSMUST00000207834]
Predicted Effect probably benign
Transcript: ENSMUST00000004770
AA Change: I145N

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004770
Gene: ENSMUSG00000004651
AA Change: I145N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
Pfam:Tyrosinase 170 403 4.8e-45 PFAM
transmembrane domain 474 496 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207164
Predicted Effect probably benign
Transcript: ENSMUST00000207834
Meta Mutation Damage Score 0.1364 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.8%
  • 20x: 84.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
Allele List at MGI

All alleles(120) : Targeted(2) Spontaneous(28) Chemically induced(16) Radiation induced(78

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,372 S275T possibly damaging Het
Adam34 G T 8: 43,651,921 T229N probably benign Het
Adgrb3 C A 1: 25,221,748 probably benign Het
Ankhd1 T A 18: 36,658,008 Y2478* probably null Het
Arl9 A G 5: 77,007,190 probably benign Het
Bub1b G A 2: 118,639,618 probably benign Het
Chl1 A T 6: 103,701,883 probably benign Het
Cobl T A 11: 12,267,072 E465V probably damaging Het
Cobll1 A T 2: 65,102,098 M520K possibly damaging Het
Dll3 A G 7: 28,296,368 V336A possibly damaging Het
Dnmbp T C 19: 43,854,846 H1193R probably damaging Het
Fbxo43 T C 15: 36,152,192 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gjc3 A T 5: 137,957,498 M175K possibly damaging Het
Gm9008 T C 6: 76,496,418 Y405C probably benign Het
Gpc5 T A 14: 115,399,151 N415K probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Il7r A T 15: 9,510,215 F251I probably benign Het
Insc A G 7: 114,792,265 E141G probably damaging Het
Itm2c C T 1: 85,907,030 T160M probably damaging Het
Mboat1 T C 13: 30,232,080 probably benign Het
Mdm2 G T 10: 117,702,204 H96Q possibly damaging Het
Mettl13 A G 1: 162,544,176 probably benign Het
Mfsd4b3 T C 10: 39,947,530 N245D probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Mymk A T 2: 27,067,406 L66Q probably damaging Het
Myo18a T C 11: 77,829,800 S767P probably damaging Het
Ndufa8 T C 2: 36,036,622 D134G probably benign Het
Noxa1 A G 2: 25,092,554 F83S probably damaging Het
Npc1l1 T A 11: 6,229,042 I123L probably benign Het
Ogdhl A G 14: 32,337,577 T394A probably benign Het
Olfr1193 T C 2: 88,678,667 S264P probably damaging Het
Olfr290 A G 7: 84,916,313 Y178C probably damaging Het
Pcdh20 T C 14: 88,468,947 T306A probably benign Het
Pcid2 G A 8: 13,090,775 probably benign Het
Phyhip G A 14: 70,463,396 V108M possibly damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Psmb4 A G 3: 94,886,091 Y160H probably benign Het
Riox2 A T 16: 59,489,389 K369* probably null Het
Sh3tc1 G A 5: 35,706,561 P761S possibly damaging Het
Slc6a3 T A 13: 73,560,926 V323D possibly damaging Het
Smg7 A G 1: 152,849,873 probably null Het
Srrt G A 5: 137,296,608 R370C probably damaging Het
Stc1 T C 14: 69,029,409 V7A probably benign Het
Svep1 G T 4: 58,057,996 probably benign Het
Tbpl2 A G 2: 24,094,979 V51A probably benign Het
Tecr A G 8: 83,572,243 Y248H probably damaging Het
Tenm3 A G 8: 48,236,912 probably benign Het
Tia1 C T 6: 86,420,387 A114V probably damaging Het
Tmprss11f A T 5: 86,591,416 M2K probably benign Het
Tnfsf8 T C 4: 63,834,166 T221A probably damaging Het
Tubgcp5 G A 7: 55,814,978 G536S probably damaging Het
Ubr4 T A 4: 139,422,418 V1809E probably damaging Het
Vmn2r65 A T 7: 84,946,548 N309K probably benign Het
Other mutations in Tyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Tyr APN 7 87437948 missense probably damaging 1.00
IGL01594:Tyr APN 7 87483814 splice site probably benign
IGL02963:Tyr APN 7 87483997 missense probably benign
IGL03356:Tyr APN 7 87492714 missense possibly damaging 0.71
ghost UTSW 7 87472495 missense probably damaging 1.00
pale_rider UTSW 7 87438023 missense probably damaging 1.00
rufus UTSW 7 87492706 missense probably damaging 1.00
siamese UTSW 7 87438044 missense probably damaging 0.99
Venusaur UTSW 7 87492706 missense probably damaging 1.00
waffle UTSW 7 87493221 missense possibly damaging 0.94
R0479:Tyr UTSW 7 87493221 missense possibly damaging 0.94
R1544:Tyr UTSW 7 87492706 missense probably damaging 1.00
R1546:Tyr UTSW 7 87437992 missense probably benign 0.02
R1606:Tyr UTSW 7 87437971 missense probably benign 0.01
R1666:Tyr UTSW 7 87492941 missense probably damaging 1.00
R2064:Tyr UTSW 7 87492843 missense probably benign 0.13
R2213:Tyr UTSW 7 87492878 missense probably damaging 1.00
R2420:Tyr UTSW 7 87429189 missense probably benign 0.17
R4013:Tyr UTSW 7 87437940 missense probably benign 0.00
R4014:Tyr UTSW 7 87437940 missense probably benign 0.00
R4015:Tyr UTSW 7 87437940 missense probably benign 0.00
R4016:Tyr UTSW 7 87437940 missense probably benign 0.00
R4202:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4205:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4206:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4361:Tyr UTSW 7 87429076 missense probably benign 0.01
R4738:Tyr UTSW 7 87492647 missense probably null 1.00
R5306:Tyr UTSW 7 87438014 missense probably damaging 1.00
R5378:Tyr UTSW 7 87472495 missense probably damaging 1.00
R5395:Tyr UTSW 7 87472490 missense probably damaging 0.98
R5782:Tyr UTSW 7 87493016 missense probably damaging 1.00
R7007:Tyr UTSW 7 87493340 missense probably benign 0.04
R7609:Tyr UTSW 7 87483884 missense probably benign 0.06
R7767:Tyr UTSW 7 87493010 missense probably benign 0.37
R7794:Tyr UTSW 7 87483820 critical splice donor site probably null
R8158:Tyr UTSW 7 87472516 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTGTGCCAAGGCAGAAACC -3'
(R):5'- TCTGGACCTCAGTTCCCCTTCAAAG -3'

Sequencing Primer
(F):5'- CTGGTGCTTCATGGGCAAAATC -3'
(R):5'- TATAATAGGACCTGCCAGTGCTC -3'
Posted On2013-04-16