Incidental Mutation 'R0322:Tecr'
ID25622
Institutional Source Beutler Lab
Gene Symbol Tecr
Ensembl Gene ENSMUSG00000031708
Gene Nametrans-2,3-enoyl-CoA reductase
SynonymsD17Ertd178e, A230102P12Rik, Gpsn2, 2410016D23Rik, SC2
MMRRC Submission 038532-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0322 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83571698-83607971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83572243 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 248 (Y248H)
Ref Sequence ENSEMBL: ENSMUSP00000019382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019382] [ENSMUST00000036996] [ENSMUST00000163837] [ENSMUST00000165740] [ENSMUST00000212005] [ENSMUST00000212630] [ENSMUST00000212703] [ENSMUST00000212990]
Predicted Effect probably damaging
Transcript: ENSMUST00000019382
AA Change: Y248H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019382
Gene: ENSMUSG00000031708
AA Change: Y248H

DomainStartEndE-ValueType
PDB:2DZJ|A 1 81 2e-49 PDB
Blast:UBQ 5 81 8e-13 BLAST
transmembrane domain 85 107 N/A INTRINSIC
Pfam:Steroid_dh 154 308 3.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036996
SMART Domains Protein: ENSMUSP00000037341
Gene: ENSMUSG00000033938

DomainStartEndE-ValueType
Pfam:NDUF_B7 40 102 3.8e-32 PFAM
low complexity region 103 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127162
Predicted Effect probably damaging
Transcript: ENSMUST00000163837
AA Change: Y302H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128329
Gene: ENSMUSG00000031708
AA Change: Y302H

DomainStartEndE-ValueType
PDB:2DZJ|A 1 135 2e-27 PDB
Blast:UBQ 91 135 1e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 362 6e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165740
AA Change: Y233H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131389
Gene: ENSMUSG00000031708
AA Change: Y233H

DomainStartEndE-ValueType
PDB:2DZJ|A 1 66 1e-31 PDB
transmembrane domain 70 92 N/A INTRINSIC
Pfam:Steroid_dh 139 293 3.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211972
Predicted Effect probably benign
Transcript: ENSMUST00000212005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212575
Predicted Effect probably benign
Transcript: ENSMUST00000212630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212652
Predicted Effect probably damaging
Transcript: ENSMUST00000212703
AA Change: Y117H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212990
AA Change: Y117H

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.8261 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.8%
  • 20x: 84.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that resides in the endoplasmic reticulum, and belongs to the steroid 5-alpha reductase family. The elongation of microsomal long and very long chain fatty acid consists of 4 sequential reactions. This protein catalyzes the final step, reducing trans-2,3-enoyl-CoA to saturated acyl-CoA. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Apr 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,372 S275T possibly damaging Het
Adam34 G T 8: 43,651,921 T229N probably benign Het
Adgrb3 C A 1: 25,221,748 probably benign Het
Ankhd1 T A 18: 36,658,008 Y2478* probably null Het
Arl9 A G 5: 77,007,190 probably benign Het
Bub1b G A 2: 118,639,618 probably benign Het
Chl1 A T 6: 103,701,883 probably benign Het
Cobl T A 11: 12,267,072 E465V probably damaging Het
Cobll1 A T 2: 65,102,098 M520K possibly damaging Het
Dll3 A G 7: 28,296,368 V336A possibly damaging Het
Dnmbp T C 19: 43,854,846 H1193R probably damaging Het
Fbxo43 T C 15: 36,152,192 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gjc3 A T 5: 137,957,498 M175K possibly damaging Het
Gm9008 T C 6: 76,496,418 Y405C probably benign Het
Gpc5 T A 14: 115,399,151 N415K probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Il7r A T 15: 9,510,215 F251I probably benign Het
Insc A G 7: 114,792,265 E141G probably damaging Het
Itm2c C T 1: 85,907,030 T160M probably damaging Het
Mboat1 T C 13: 30,232,080 probably benign Het
Mdm2 G T 10: 117,702,204 H96Q possibly damaging Het
Mettl13 A G 1: 162,544,176 probably benign Het
Mfsd4b3 T C 10: 39,947,530 N245D probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Mymk A T 2: 27,067,406 L66Q probably damaging Het
Myo18a T C 11: 77,829,800 S767P probably damaging Het
Ndufa8 T C 2: 36,036,622 D134G probably benign Het
Noxa1 A G 2: 25,092,554 F83S probably damaging Het
Npc1l1 T A 11: 6,229,042 I123L probably benign Het
Ogdhl A G 14: 32,337,577 T394A probably benign Het
Olfr1193 T C 2: 88,678,667 S264P probably damaging Het
Olfr290 A G 7: 84,916,313 Y178C probably damaging Het
Pcdh20 T C 14: 88,468,947 T306A probably benign Het
Pcid2 G A 8: 13,090,775 probably benign Het
Phyhip G A 14: 70,463,396 V108M possibly damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Psmb4 A G 3: 94,886,091 Y160H probably benign Het
Riox2 A T 16: 59,489,389 K369* probably null Het
Sh3tc1 G A 5: 35,706,561 P761S possibly damaging Het
Slc6a3 T A 13: 73,560,926 V323D possibly damaging Het
Smg7 A G 1: 152,849,873 probably null Het
Srrt G A 5: 137,296,608 R370C probably damaging Het
Stc1 T C 14: 69,029,409 V7A probably benign Het
Svep1 G T 4: 58,057,996 probably benign Het
Tbpl2 A G 2: 24,094,979 V51A probably benign Het
Tenm3 A G 8: 48,236,912 probably benign Het
Tia1 C T 6: 86,420,387 A114V probably damaging Het
Tmprss11f A T 5: 86,591,416 M2K probably benign Het
Tnfsf8 T C 4: 63,834,166 T221A probably damaging Het
Tubgcp5 G A 7: 55,814,978 G536S probably damaging Het
Tyr A T 7: 87,492,917 I145N probably benign Het
Ubr4 T A 4: 139,422,418 V1809E probably damaging Het
Vmn2r65 A T 7: 84,946,548 N309K probably benign Het
Other mutations in Tecr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02240:Tecr APN 8 83573416 missense probably damaging 0.97
PIT4810001:Tecr UTSW 8 83572255 missense probably damaging 1.00
R0349:Tecr UTSW 8 83572275 missense probably damaging 1.00
R0708:Tecr UTSW 8 83573109 missense probably damaging 0.97
R2517:Tecr UTSW 8 83572575 missense probably benign 0.05
R7331:Tecr UTSW 8 83571935 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAAGATGGCAAAGCCAATCCAG -3'
(R):5'- GGAACTTCTCCATCCACATGGCTC -3'

Sequencing Primer
(F):5'- ACCTGTGGACAGTACAGGC -3'
(R):5'- CACATGGCTCTTCGGGAC -3'
Posted On2013-04-16