Incidental Mutation 'R0322:Npc1l1'
ID25625
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
MMRRC Submission 038532-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R0322 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6229042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 123 (I123L)
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect probably benign
Transcript: ENSMUST00000004505
AA Change: I123L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: I123L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.8%
  • 20x: 84.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,372 S275T possibly damaging Het
Adam34 G T 8: 43,651,921 T229N probably benign Het
Adgrb3 C A 1: 25,221,748 probably benign Het
Ankhd1 T A 18: 36,658,008 Y2478* probably null Het
Arl9 A G 5: 77,007,190 probably benign Het
Bub1b G A 2: 118,639,618 probably benign Het
Chl1 A T 6: 103,701,883 probably benign Het
Cobl T A 11: 12,267,072 E465V probably damaging Het
Cobll1 A T 2: 65,102,098 M520K possibly damaging Het
Dll3 A G 7: 28,296,368 V336A possibly damaging Het
Dnmbp T C 19: 43,854,846 H1193R probably damaging Het
Fbxo43 T C 15: 36,152,192 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gjc3 A T 5: 137,957,498 M175K possibly damaging Het
Gm9008 T C 6: 76,496,418 Y405C probably benign Het
Gpc5 T A 14: 115,399,151 N415K probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Il7r A T 15: 9,510,215 F251I probably benign Het
Insc A G 7: 114,792,265 E141G probably damaging Het
Itm2c C T 1: 85,907,030 T160M probably damaging Het
Mboat1 T C 13: 30,232,080 probably benign Het
Mdm2 G T 10: 117,702,204 H96Q possibly damaging Het
Mettl13 A G 1: 162,544,176 probably benign Het
Mfsd4b3 T C 10: 39,947,530 N245D probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Mymk A T 2: 27,067,406 L66Q probably damaging Het
Myo18a T C 11: 77,829,800 S767P probably damaging Het
Ndufa8 T C 2: 36,036,622 D134G probably benign Het
Noxa1 A G 2: 25,092,554 F83S probably damaging Het
Ogdhl A G 14: 32,337,577 T394A probably benign Het
Olfr1193 T C 2: 88,678,667 S264P probably damaging Het
Olfr290 A G 7: 84,916,313 Y178C probably damaging Het
Pcdh20 T C 14: 88,468,947 T306A probably benign Het
Pcid2 G A 8: 13,090,775 probably benign Het
Phyhip G A 14: 70,463,396 V108M possibly damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Psmb4 A G 3: 94,886,091 Y160H probably benign Het
Riox2 A T 16: 59,489,389 K369* probably null Het
Sh3tc1 G A 5: 35,706,561 P761S possibly damaging Het
Slc6a3 T A 13: 73,560,926 V323D possibly damaging Het
Smg7 A G 1: 152,849,873 probably null Het
Srrt G A 5: 137,296,608 R370C probably damaging Het
Stc1 T C 14: 69,029,409 V7A probably benign Het
Svep1 G T 4: 58,057,996 probably benign Het
Tbpl2 A G 2: 24,094,979 V51A probably benign Het
Tecr A G 8: 83,572,243 Y248H probably damaging Het
Tenm3 A G 8: 48,236,912 probably benign Het
Tia1 C T 6: 86,420,387 A114V probably damaging Het
Tmprss11f A T 5: 86,591,416 M2K probably benign Het
Tnfsf8 T C 4: 63,834,166 T221A probably damaging Het
Tubgcp5 G A 7: 55,814,978 G536S probably damaging Het
Tyr A T 7: 87,492,917 I145N probably benign Het
Ubr4 T A 4: 139,422,418 V1809E probably damaging Het
Vmn2r65 A T 7: 84,946,548 N309K probably benign Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R0918:Npc1l1 UTSW 11 6218239 missense probably damaging 1.00
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1455:Npc1l1 UTSW 11 6228174 missense possibly damaging 0.66
R1588:Npc1l1 UTSW 11 6217785 missense probably benign 0.01
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1944:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5290:Npc1l1 UTSW 11 6222221 missense probably benign 0.00
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6388:Npc1l1 UTSW 11 6224145 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214013 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R6790:Npc1l1 UTSW 11 6214260 splice site probably null
R7006:Npc1l1 UTSW 11 6217731 missense probably benign
R7062:Npc1l1 UTSW 11 6217807 missense probably benign
R7273:Npc1l1 UTSW 11 6218320 missense probably damaging 1.00
R7383:Npc1l1 UTSW 11 6217777 missense probably benign 0.30
R8003:Npc1l1 UTSW 11 6215129 missense probably benign 0.01
R8081:Npc1l1 UTSW 11 6217768 missense probably benign 0.01
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Z1177:Npc1l1 UTSW 11 6214343 missense probably damaging 1.00
Z1177:Npc1l1 UTSW 11 6218681 missense probably damaging 0.99
Z1177:Npc1l1 UTSW 11 6225209 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATTGCAGAGGGCAGAGCCATACAC -3'
(R):5'- TTGGCACCCTAAGCATAGCACG -3'

Sequencing Primer
(F):5'- ATGCTGCCCACAGCCAG -3'
(R):5'- TGTGCCAACCAGCCTTAG -3'
Posted On2013-04-16