Incidental Mutation 'R0323:Agps'
ID25643
Institutional Source Beutler Lab
Gene Symbol Agps
Ensembl Gene ENSMUSG00000042410
Gene Namealkylglycerone phosphate synthase
Synonymsbs2, ADAPS, 9930035G10Rik
MMRRC Submission 038533-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0323 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location75832177-75931350 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 75894161 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 506 (Y506*)
Ref Sequence ENSEMBL: ENSMUSP00000107583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047232] [ENSMUST00000111952] [ENSMUST00000175646]
Predicted Effect probably benign
Transcript: ENSMUST00000047232
SMART Domains Protein: ENSMUSP00000041967
Gene: ENSMUSG00000042410

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
Pfam:FAD_binding_4 219 362 3.2e-43 PFAM
Pfam:FAD-oxidase_C 397 670 4.2e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111952
AA Change: Y506*
SMART Domains Protein: ENSMUSP00000107583
Gene: ENSMUSG00000042410
AA Change: Y506*

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
Pfam:FAD_binding_4 219 362 4.7e-43 PFAM
Pfam:FAD-oxidase_C 397 508 5.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175646
SMART Domains Protein: ENSMUSP00000135457
Gene: ENSMUSG00000042410

DomainStartEndE-ValueType
Pfam:FAD_binding_4 116 259 1.2e-43 PFAM
Pfam:FAD-oxidase_C 294 567 2.6e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176626
Predicted Effect probably benign
Transcript: ENSMUST00000176973
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 94.2%
  • 20x: 86.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the FAD-binding oxidoreductase/transferase type 4 family. It encodes a protein that catalyzes the second step of ether lipid biosynthesis in which acyl-dihydroxyacetonephosphate (DHAP) is converted to alkyl-DHAP by the addition of a long chain alcohol and the removal of a long-chain acid anion. The protein is localized to the inner aspect of the peroxisomal membrane and requires FAD as a cofactor. Mutations in this gene have been associated with rhizomelic chondrodysplasia punctata, type 3 and Zellweger syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit male infertility, azoospermia, microphthalmia, and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,298,555 T816S possibly damaging Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
4931429P17Rik A C 13: 47,961,017 noncoding transcript Het
4932438A13Rik T A 3: 36,943,182 C1129* probably null Het
Abca13 A C 11: 9,294,701 D2188A probably benign Het
Accsl T A 2: 93,861,080 Q351L probably benign Het
Acot6 A C 12: 84,109,179 E300D probably benign Het
Adgre1 T A 17: 57,444,060 I578N probably benign Het
Agbl4 T C 4: 111,617,222 S403P probably damaging Het
Appl1 A T 14: 26,942,738 V446D possibly damaging Het
Arcn1 A T 9: 44,759,059 I90N probably damaging Het
Aspscr1 G A 11: 120,678,420 V15I probably damaging Het
Asxl2 A G 12: 3,442,487 Y24C probably damaging Het
Atp8b1 A G 18: 64,568,252 F345S possibly damaging Het
Barx1 A G 13: 48,665,954 T243A probably benign Het
Bmp2k A G 5: 97,087,823 probably benign Het
Cacul1 A G 19: 60,543,060 I257T probably benign Het
Chml A T 1: 175,687,084 F424I probably benign Het
Clcn1 A T 6: 42,310,140 E710D probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cylc2 T A 4: 51,228,477 S183T unknown Het
Dhtkd1 T A 2: 5,914,888 M561L probably benign Het
Dirc2 ACC AC 16: 35,719,360 probably null Het
Dnajc13 A G 9: 104,156,892 S2188P probably damaging Het
Dyrk1b C A 7: 28,185,356 Q399K probably benign Het
Erc1 T C 6: 119,620,328 K1003E probably damaging Het
Ezr G A 17: 6,754,765 Q105* probably null Het
Fam83d T A 2: 158,785,547 D385E probably benign Het
Fbn2 A G 18: 58,045,317 C1950R probably damaging Het
Fbxo32 A T 15: 58,184,209 I236N probably damaging Het
Fcgr1 T C 3: 96,285,829 E284G possibly damaging Het
Foxe3 T C 4: 114,925,608 N136D probably damaging Het
Fscn2 A T 11: 120,368,011 I461F probably damaging Het
Fsip2 T C 2: 82,985,896 I3991T probably benign Het
Galnt15 A T 14: 32,048,085 H249L probably damaging Het
Gm10803 T A 2: 93,564,070 Y62* probably null Het
Gm20730 G A 6: 43,081,515 probably null Het
Gm4841 A G 18: 60,270,646 L125S possibly damaging Het
Gmpr2 A G 14: 55,672,746 D11G probably damaging Het
Gucy1b1 T A 3: 82,038,156 probably null Het
Hhla1 C A 15: 65,948,503 V133F probably benign Het
Hscb T C 5: 110,834,690 E177G possibly damaging Het
Hyal4 A T 6: 24,756,194 N137I probably benign Het
Lcp2 A G 11: 34,054,322 D53G probably damaging Het
Ldb3 G A 14: 34,544,045 T531I probably damaging Het
Llgl2 A G 11: 115,850,720 K559E probably damaging Het
Loxhd1 A G 18: 77,369,137 I499V probably benign Het
Lrp2 T C 2: 69,469,639 Y3023C probably damaging Het
Lrrc59 A C 11: 94,643,422 T269P probably damaging Het
Lrriq1 A T 10: 103,221,289 C217S possibly damaging Het
Mmrn2 A T 14: 34,398,034 Q287L probably damaging Het
Mplkip A G 13: 17,696,980 I159V possibly damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Nrxn1 A C 17: 90,700,742 probably null Het
Olfr1130 G A 2: 87,607,497 M36I probably benign Het
Olfr215 A T 6: 116,582,601 V115E probably damaging Het
Olfr23 A T 11: 73,940,947 I234F probably benign Het
Olfr430 A G 1: 174,069,327 T10A probably benign Het
Olfr814 T A 10: 129,874,067 Q230L probably damaging Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Palm3 T A 8: 84,028,720 V287D probably damaging Het
Pde11a C T 2: 76,046,774 probably null Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pkhd1 A T 1: 20,275,538 D2755E probably benign Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Polrmt T C 10: 79,741,998 T287A probably benign Het
Ppfia2 A G 10: 106,896,420 I943V possibly damaging Het
Pth2r A C 1: 65,388,616 I483L probably benign Het
Qrsl1 A G 10: 43,896,007 probably null Het
Ralgapa1 A T 12: 55,677,238 I1548N probably damaging Het
Scn9a T C 2: 66,568,131 E45G probably damaging Het
Sf3b1 T C 1: 55,019,257 I58V probably damaging Het
Sh3d19 T A 3: 86,126,671 M777K probably benign Het
Shc1 T C 3: 89,423,713 L106P probably damaging Het
Skint5 T C 4: 113,937,621 H255R probably benign Het
Slc28a3 C A 13: 58,564,052 G487* probably null Het
Slfn4 A T 11: 83,186,951 R188S probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Spta1 A G 1: 174,218,451 T1594A probably damaging Het
Srarp G A 4: 141,433,379 Q48* probably null Het
Srf T C 17: 46,549,489 T456A possibly damaging Het
Stx2 C T 5: 128,988,903 V230I probably benign Het
Tenm4 C A 7: 96,694,950 P250Q possibly damaging Het
Tnrc6c A G 11: 117,739,881 K1023E probably damaging Het
Trpc6 A T 9: 8,610,275 H248L probably damaging Het
Trpc6 A G 9: 8,643,536 K441E probably damaging Het
Uty T A Y: 1,169,979 I326F probably damaging Het
Vmn1r63 A G 7: 5,803,336 V99A probably benign Het
Wnt11 A G 7: 98,847,383 K177E probably damaging Het
Wwc1 T A 11: 35,852,348 E882V probably damaging Het
Zfhx2 C A 14: 55,065,979 S1516I possibly damaging Het
Zmpste24 A G 4: 121,082,853 Y199H probably damaging Het
Other mutations in Agps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Agps APN 2 75925972 missense probably benign 0.00
IGL01373:Agps APN 2 75852784 missense probably benign 0.00
IGL01958:Agps APN 2 75909701 critical splice donor site probably null
IGL02691:Agps APN 2 75891860 missense probably benign 0.04
R0087:Agps UTSW 2 75909635 missense probably damaging 1.00
R1116:Agps UTSW 2 75861925 splice site probably benign
R1511:Agps UTSW 2 75866779 missense probably damaging 1.00
R2049:Agps UTSW 2 75858926 missense probably benign
R4770:Agps UTSW 2 75891855 missense possibly damaging 0.94
R5418:Agps UTSW 2 75858904 missense probably damaging 1.00
R5457:Agps UTSW 2 75854252 missense probably benign 0.01
R6795:Agps UTSW 2 75894058 missense probably damaging 0.98
R7286:Agps UTSW 2 75852784 missense probably benign 0.22
R7367:Agps UTSW 2 75868313 missense possibly damaging 0.67
R7529:Agps UTSW 2 75832352 missense possibly damaging 0.85
R7842:Agps UTSW 2 75851532 missense probably damaging 1.00
R7920:Agps UTSW 2 75854107 intron probably null
R7925:Agps UTSW 2 75851532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTTACAGAGGCTAAGGCTTCACTG -3'
(R):5'- AACGTGGTCCTGACAAACGGCA -3'

Sequencing Primer
(F):5'- GGCTAAGGCTTCACTGTAATAATAC -3'
(R):5'- TAGGTAAAAGTGACACATCAGTCC -3'
Posted On2013-04-16