Incidental Mutation 'R0323:Olfr1130'
ID25646
Institutional Source Beutler Lab
Gene Symbol Olfr1130
Ensembl Gene ENSMUSG00000059205
Gene Nameolfactory receptor 1130
SynonymsMOR264-4, GA_x6K02T2Q125-49112575-49113519
MMRRC Submission 038533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R0323 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87606212-87609852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87607497 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 36 (M36I)
Ref Sequence ENSEMBL: ENSMUSP00000150905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000213103] [ENSMUST00000216580]
Predicted Effect probably benign
Transcript: ENSMUST00000079711
AA Change: M36I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: M36I

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213103
AA Change: M36I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216580
AA Change: M36I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 94.2%
  • 20x: 86.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,298,555 T816S possibly damaging Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
4931429P17Rik A C 13: 47,961,017 noncoding transcript Het
4932438A13Rik T A 3: 36,943,182 C1129* probably null Het
Abca13 A C 11: 9,294,701 D2188A probably benign Het
Accsl T A 2: 93,861,080 Q351L probably benign Het
Acot6 A C 12: 84,109,179 E300D probably benign Het
Adgre1 T A 17: 57,444,060 I578N probably benign Het
Agbl4 T C 4: 111,617,222 S403P probably damaging Het
Agps T A 2: 75,894,161 Y506* probably null Het
Appl1 A T 14: 26,942,738 V446D possibly damaging Het
Arcn1 A T 9: 44,759,059 I90N probably damaging Het
Aspscr1 G A 11: 120,678,420 V15I probably damaging Het
Asxl2 A G 12: 3,442,487 Y24C probably damaging Het
Atp8b1 A G 18: 64,568,252 F345S possibly damaging Het
Barx1 A G 13: 48,665,954 T243A probably benign Het
Bmp2k A G 5: 97,087,823 probably benign Het
Cacul1 A G 19: 60,543,060 I257T probably benign Het
Chml A T 1: 175,687,084 F424I probably benign Het
Clcn1 A T 6: 42,310,140 E710D probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cylc2 T A 4: 51,228,477 S183T unknown Het
Dhtkd1 T A 2: 5,914,888 M561L probably benign Het
Dirc2 ACC AC 16: 35,719,360 probably null Het
Dnajc13 A G 9: 104,156,892 S2188P probably damaging Het
Dyrk1b C A 7: 28,185,356 Q399K probably benign Het
Erc1 T C 6: 119,620,328 K1003E probably damaging Het
Ezr G A 17: 6,754,765 Q105* probably null Het
Fam83d T A 2: 158,785,547 D385E probably benign Het
Fbn2 A G 18: 58,045,317 C1950R probably damaging Het
Fbxo32 A T 15: 58,184,209 I236N probably damaging Het
Fcgr1 T C 3: 96,285,829 E284G possibly damaging Het
Foxe3 T C 4: 114,925,608 N136D probably damaging Het
Fscn2 A T 11: 120,368,011 I461F probably damaging Het
Fsip2 T C 2: 82,985,896 I3991T probably benign Het
Galnt15 A T 14: 32,048,085 H249L probably damaging Het
Gm10803 T A 2: 93,564,070 Y62* probably null Het
Gm20730 G A 6: 43,081,515 probably null Het
Gm4841 A G 18: 60,270,646 L125S possibly damaging Het
Gmpr2 A G 14: 55,672,746 D11G probably damaging Het
Gucy1b1 T A 3: 82,038,156 probably null Het
Hhla1 C A 15: 65,948,503 V133F probably benign Het
Hscb T C 5: 110,834,690 E177G possibly damaging Het
Hyal4 A T 6: 24,756,194 N137I probably benign Het
Lcp2 A G 11: 34,054,322 D53G probably damaging Het
Ldb3 G A 14: 34,544,045 T531I probably damaging Het
Llgl2 A G 11: 115,850,720 K559E probably damaging Het
Loxhd1 A G 18: 77,369,137 I499V probably benign Het
Lrp2 T C 2: 69,469,639 Y3023C probably damaging Het
Lrrc59 A C 11: 94,643,422 T269P probably damaging Het
Lrriq1 A T 10: 103,221,289 C217S possibly damaging Het
Mmrn2 A T 14: 34,398,034 Q287L probably damaging Het
Mplkip A G 13: 17,696,980 I159V possibly damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Nrxn1 A C 17: 90,700,742 probably null Het
Olfr215 A T 6: 116,582,601 V115E probably damaging Het
Olfr23 A T 11: 73,940,947 I234F probably benign Het
Olfr430 A G 1: 174,069,327 T10A probably benign Het
Olfr814 T A 10: 129,874,067 Q230L probably damaging Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Palm3 T A 8: 84,028,720 V287D probably damaging Het
Pde11a C T 2: 76,046,774 probably null Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pkhd1 A T 1: 20,275,538 D2755E probably benign Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Polrmt T C 10: 79,741,998 T287A probably benign Het
Ppfia2 A G 10: 106,896,420 I943V possibly damaging Het
Pth2r A C 1: 65,388,616 I483L probably benign Het
Qrsl1 A G 10: 43,896,007 probably null Het
Ralgapa1 A T 12: 55,677,238 I1548N probably damaging Het
Scn9a T C 2: 66,568,131 E45G probably damaging Het
Sf3b1 T C 1: 55,019,257 I58V probably damaging Het
Sh3d19 T A 3: 86,126,671 M777K probably benign Het
Shc1 T C 3: 89,423,713 L106P probably damaging Het
Skint5 T C 4: 113,937,621 H255R probably benign Het
Slc28a3 C A 13: 58,564,052 G487* probably null Het
Slfn4 A T 11: 83,186,951 R188S probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Spta1 A G 1: 174,218,451 T1594A probably damaging Het
Srarp G A 4: 141,433,379 Q48* probably null Het
Srf T C 17: 46,549,489 T456A possibly damaging Het
Stx2 C T 5: 128,988,903 V230I probably benign Het
Tenm4 C A 7: 96,694,950 P250Q possibly damaging Het
Tnrc6c A G 11: 117,739,881 K1023E probably damaging Het
Trpc6 A T 9: 8,610,275 H248L probably damaging Het
Trpc6 A G 9: 8,643,536 K441E probably damaging Het
Uty T A Y: 1,169,979 I326F probably damaging Het
Vmn1r63 A G 7: 5,803,336 V99A probably benign Het
Wnt11 A G 7: 98,847,383 K177E probably damaging Het
Wwc1 T A 11: 35,852,348 E882V probably damaging Het
Zfhx2 C A 14: 55,065,979 S1516I possibly damaging Het
Zmpste24 A G 4: 121,082,853 Y199H probably damaging Het
Other mutations in Olfr1130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Olfr1130 APN 2 87607979 missense probably damaging 1.00
IGL01310:Olfr1130 APN 2 87607508 missense possibly damaging 0.68
IGL02558:Olfr1130 APN 2 87607559 missense probably benign 0.00
R0590:Olfr1130 UTSW 2 87607994 missense probably damaging 0.98
R0718:Olfr1130 UTSW 2 87607927 missense probably benign 0.08
R2445:Olfr1130 UTSW 2 87607958 missense probably damaging 0.99
R3408:Olfr1130 UTSW 2 87607876 missense probably benign 0.03
R4280:Olfr1130 UTSW 2 87608251 missense possibly damaging 0.90
R4491:Olfr1130 UTSW 2 87607392 start codon destroyed probably null 0.84
R4928:Olfr1130 UTSW 2 87608143 missense probably benign 0.06
R5033:Olfr1130 UTSW 2 87607711 missense probably damaging 1.00
R5061:Olfr1130 UTSW 2 87607832 missense probably benign 0.00
R5109:Olfr1130 UTSW 2 87607411 missense possibly damaging 0.64
R5109:Olfr1130 UTSW 2 87607975 missense possibly damaging 0.78
R5772:Olfr1130 UTSW 2 87608173 missense probably benign 0.12
R6004:Olfr1130 UTSW 2 87607909 missense probably damaging 1.00
R6005:Olfr1130 UTSW 2 87608080 missense probably damaging 0.97
R6411:Olfr1130 UTSW 2 87607973 missense probably damaging 1.00
R6964:Olfr1130 UTSW 2 87607613 missense probably damaging 1.00
R7085:Olfr1130 UTSW 2 87607406 missense probably benign 0.00
R7484:Olfr1130 UTSW 2 87607937 missense probably damaging 1.00
X0060:Olfr1130 UTSW 2 87608042 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCCTCAAGGGCAATGGAAATGTCG -3'
(R):5'- GGTCATAAGACATCACAGCCAGCAG -3'

Sequencing Primer
(F):5'- TGTCGAAAGGGTATTAACATTGC -3'
(R):5'- CTGAGGACAGAAATCTTTCTCTCTTG -3'
Posted On2013-04-16